Incidental Mutation 'R8421:Mrpl1'
ID653188
Institutional Source Beutler Lab
Gene Symbol Mrpl1
Ensembl Gene ENSMUSG00000029486
Gene Namemitochondrial ribosomal protein L1
Synonyms5830418D04Rik, 2410002L03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R8421 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location96209493-96266727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 96226367 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 167 (A167G)
Ref Sequence ENSEMBL: ENSMUSP00000037046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036437] [ENSMUST00000117766] [ENSMUST00000121477]
Predicted Effect probably benign
Transcript: ENSMUST00000036437
AA Change: A167G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037046
Gene: ENSMUSG00000029486
AA Change: A167G

DomainStartEndE-ValueType
Pfam:MRL1 2 165 1.3e-56 PFAM
Pfam:Ribosomal_L1 55 307 3e-17 PFAM
low complexity region 318 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117766
AA Change: A167G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112977
Gene: ENSMUSG00000029486
AA Change: A167G

DomainStartEndE-ValueType
Pfam:Ribosomal_L1 55 307 3.1e-18 PFAM
low complexity region 318 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121477
AA Change: A167G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112451
Gene: ENSMUSG00000029486
AA Change: A167G

DomainStartEndE-ValueType
Pfam:MRL1 1 165 9.5e-57 PFAM
Pfam:Ribosomal_L1 56 269 3.4e-10 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein that belongs to the L1 ribosomal protein family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,218,610 K275* probably null Het
Acin1 T C 14: 54,643,029 E1239G unknown Het
Actn3 T C 19: 4,861,713 M806V probably benign Het
Adcy7 A G 8: 88,322,184 T676A probably benign Het
Ankef1 C A 2: 136,537,165 Q12K probably damaging Het
Ankrd40 G T 11: 94,334,836 G231V probably damaging Het
Atad5 T A 11: 80,094,558 V157D probably damaging Het
Atp6v1b1 T A 6: 83,753,809 M163K probably damaging Het
Atp7b A T 8: 22,028,471 M117K probably benign Het
Ccdc87 T C 19: 4,841,285 Y602H possibly damaging Het
Cdh16 C T 8: 104,621,970 R142K probably benign Het
Chrnb3 G A 8: 27,396,690 V431I probably damaging Het
Csf1r A G 18: 61,127,894 D719G probably damaging Het
Ctsll3 A G 13: 60,800,781 F88S probably damaging Het
Dglucy A G 12: 100,842,679 Y212C probably damaging Het
Dnase1l3 T C 14: 7,968,122 D261G possibly damaging Het
Dync2h1 T C 9: 7,102,477 D2641G probably damaging Het
E330021D16Rik T C 6: 136,401,352 E160G probably damaging Het
Fat3 A T 9: 15,998,184 V2174D probably damaging Het
Gtf3c1 A G 7: 125,698,970 L244P probably damaging Het
Hcn4 T A 9: 58,858,096 D620E unknown Het
Ide A G 19: 37,278,004 V800A Het
Ikbkb A T 8: 22,678,788 probably null Het
Lin9 T A 1: 180,665,800 F197Y probably damaging Het
Lrp1b T A 2: 40,725,423 Y3656F Het
Mapkbp1 C A 2: 120,018,950 N708K probably damaging Het
Marveld3 A G 8: 109,948,647 M179T probably benign Het
Mrpl35 T C 6: 71,816,167 K167E probably damaging Het
Myo3a T C 2: 22,362,124 V594A probably benign Het
Nav2 A G 7: 49,452,521 T356A probably benign Het
Nup210l A G 3: 90,203,867 Y1692C probably damaging Het
Olfr1054 T A 2: 86,332,903 Y151F possibly damaging Het
Otoa G A 7: 121,099,268 probably null Het
Oxnad1 T G 14: 32,099,474 I172S probably benign Het
Padi4 C A 4: 140,748,222 C544F probably damaging Het
Pard3 A C 8: 127,140,408 probably benign Het
Plvap G A 8: 71,511,532 T62M probably damaging Het
Prdm8 C T 5: 98,185,963 A463V probably damaging Het
Prss21 T A 17: 23,869,368 D102E possibly damaging Het
Psmb10 G T 8: 105,936,710 Q182K probably benign Het
Rasgrf1 C T 9: 89,967,915 P319S probably damaging Het
Rock1 G A 18: 10,072,863 Q1161* probably null Het
Ryr3 T C 2: 112,996,584 E112G probably benign Het
Samm50 A G 15: 84,210,585 T393A probably benign Het
Slc9c1 A G 16: 45,593,371 E954G probably damaging Het
Sulf2 T A 2: 166,117,052 I79F probably benign Het
Tbx21 T C 11: 97,114,735 K135E probably benign Het
Unc13b A G 4: 43,178,304 E3044G unknown Het
Usf3 A T 16: 44,217,209 Q684L possibly damaging Het
Vmn1r114 A T 7: 20,811,534 M218K possibly damaging Het
Vmn1r203 T G 13: 22,524,984 *312G probably null Het
Vmn2r67 A C 7: 85,136,685 L704R probably damaging Het
Zfp618 A G 4: 63,133,246 T755A probably damaging Het
Zp3 A G 5: 135,988,477 T381A probably benign Het
Zscan20 T C 4: 128,585,827 D957G probably damaging Het
Other mutations in Mrpl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Mrpl1 APN 5 96226285 missense probably damaging 1.00
IGL01068:Mrpl1 APN 5 96224036 splice site probably benign
IGL02172:Mrpl1 APN 5 96231715 missense probably damaging 0.96
R0908:Mrpl1 UTSW 5 96262083 missense probably benign 0.01
R1726:Mrpl1 UTSW 5 96223827 missense probably benign 0.00
R1827:Mrpl1 UTSW 5 96226343 missense possibly damaging 0.55
R4387:Mrpl1 UTSW 5 96238919 missense possibly damaging 0.48
R4636:Mrpl1 UTSW 5 96210175 missense probably benign 0.04
R5974:Mrpl1 UTSW 5 96231794 critical splice donor site probably null
R7062:Mrpl1 UTSW 5 96213791 missense probably benign 0.16
R8241:Mrpl1 UTSW 5 96238874 missense probably damaging 0.97
R8377:Mrpl1 UTSW 5 96226367 missense probably benign
R8419:Mrpl1 UTSW 5 96226367 missense probably benign
R8461:Mrpl1 UTSW 5 96213787 missense probably damaging 1.00
Z1088:Mrpl1 UTSW 5 96262069 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACGAAATGGGGTGTGATG -3'
(R):5'- TGTGACCAGTGCTAACCGTG -3'

Sequencing Primer
(F):5'- TATTCCCAGCATTCAGGAAGCTGAG -3'
(R):5'- TAACCGTGGCAGCAGTG -3'
Posted On2020-10-20