Incidental Mutation 'R8421:Atad5'
ID653211
Institutional Source Beutler Lab
Gene Symbol Atad5
Ensembl Gene ENSMUSG00000017550
Gene NameATPase family, AAA domain containing 5
SynonymsLOC237877, C130052G03Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8421 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location80089400-80135794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80094558 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 157 (V157D)
Ref Sequence ENSEMBL: ENSMUSP00000017694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017694] [ENSMUST00000108239]
Predicted Effect probably damaging
Transcript: ENSMUST00000017694
AA Change: V157D

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000017694
Gene: ENSMUSG00000017550
AA Change: V157D

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1111 1347 5.14e-5 SMART
Blast:AAA 1409 1526 1e-31 BLAST
low complexity region 1573 1583 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108239
AA Change: V157D

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103874
Gene: ENSMUSG00000017550
AA Change: V157D

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1108 1344 5.14e-5 SMART
Blast:AAA 1406 1523 1e-31 BLAST
low complexity region 1570 1580 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit prenatal lethality. Mice heterozygous for a gene trap allele exhibit genomic instability, premature death, and a wide spectrum of spontaneous tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,218,610 K275* probably null Het
Acin1 T C 14: 54,643,029 E1239G unknown Het
Actn3 T C 19: 4,861,713 M806V probably benign Het
Adcy7 A G 8: 88,322,184 T676A probably benign Het
Ankef1 C A 2: 136,537,165 Q12K probably damaging Het
Ankrd40 G T 11: 94,334,836 G231V probably damaging Het
Atp6v1b1 T A 6: 83,753,809 M163K probably damaging Het
Atp7b A T 8: 22,028,471 M117K probably benign Het
Ccdc87 T C 19: 4,841,285 Y602H possibly damaging Het
Cdh16 C T 8: 104,621,970 R142K probably benign Het
Chrnb3 G A 8: 27,396,690 V431I probably damaging Het
Csf1r A G 18: 61,127,894 D719G probably damaging Het
Ctsll3 A G 13: 60,800,781 F88S probably damaging Het
Dglucy A G 12: 100,842,679 Y212C probably damaging Het
Dnase1l3 T C 14: 7,968,122 D261G possibly damaging Het
Dync2h1 T C 9: 7,102,477 D2641G probably damaging Het
E330021D16Rik T C 6: 136,401,352 E160G probably damaging Het
Fat3 A T 9: 15,998,184 V2174D probably damaging Het
Gtf3c1 A G 7: 125,698,970 L244P probably damaging Het
Hcn4 T A 9: 58,858,096 D620E unknown Het
Ide A G 19: 37,278,004 V800A Het
Ikbkb A T 8: 22,678,788 probably null Het
Lin9 T A 1: 180,665,800 F197Y probably damaging Het
Lrp1b T A 2: 40,725,423 Y3656F Het
Mapkbp1 C A 2: 120,018,950 N708K probably damaging Het
Marveld3 A G 8: 109,948,647 M179T probably benign Het
Mrpl1 C G 5: 96,226,367 A167G probably benign Het
Mrpl35 T C 6: 71,816,167 K167E probably damaging Het
Myo3a T C 2: 22,362,124 V594A probably benign Het
Nav2 A G 7: 49,452,521 T356A probably benign Het
Nup210l A G 3: 90,203,867 Y1692C probably damaging Het
Olfr1054 T A 2: 86,332,903 Y151F possibly damaging Het
Otoa G A 7: 121,099,268 probably null Het
Oxnad1 T G 14: 32,099,474 I172S probably benign Het
Padi4 C A 4: 140,748,222 C544F probably damaging Het
Pard3 A C 8: 127,140,408 probably benign Het
Plvap G A 8: 71,511,532 T62M probably damaging Het
Prdm8 C T 5: 98,185,963 A463V probably damaging Het
Prss21 T A 17: 23,869,368 D102E possibly damaging Het
Psmb10 G T 8: 105,936,710 Q182K probably benign Het
Rasgrf1 C T 9: 89,967,915 P319S probably damaging Het
Rock1 G A 18: 10,072,863 Q1161* probably null Het
Ryr3 T C 2: 112,996,584 E112G probably benign Het
Samm50 A G 15: 84,210,585 T393A probably benign Het
Slc9c1 A G 16: 45,593,371 E954G probably damaging Het
Sulf2 T A 2: 166,117,052 I79F probably benign Het
Tbx21 T C 11: 97,114,735 K135E probably benign Het
Unc13b A G 4: 43,178,304 E3044G unknown Het
Usf3 A T 16: 44,217,209 Q684L possibly damaging Het
Vmn1r114 A T 7: 20,811,534 M218K possibly damaging Het
Vmn1r203 T G 13: 22,524,984 *312G probably null Het
Vmn2r67 A C 7: 85,136,685 L704R probably damaging Het
Zfp618 A G 4: 63,133,246 T755A probably damaging Het
Zp3 A G 5: 135,988,477 T381A probably benign Het
Zscan20 T C 4: 128,585,827 D957G probably damaging Het
Other mutations in Atad5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Atad5 APN 11 80132858 missense probably benign 0.22
IGL00916:Atad5 APN 11 80119000 missense probably damaging 1.00
IGL01348:Atad5 APN 11 80095564 missense probably benign 0.00
IGL01601:Atad5 APN 11 80095517 missense probably benign 0.45
IGL01916:Atad5 APN 11 80112839 critical splice donor site probably null
IGL02028:Atad5 APN 11 80134110 missense probably benign 0.20
IGL02095:Atad5 APN 11 80094707 missense probably benign 0.24
IGL02142:Atad5 APN 11 80094197 missense probably benign 0.00
IGL02206:Atad5 APN 11 80094183 missense probably damaging 1.00
IGL02385:Atad5 APN 11 80094627 missense probably benign 0.04
IGL02858:Atad5 APN 11 80089775 missense probably damaging 1.00
IGL02962:Atad5 APN 11 80108579 missense possibly damaging 0.86
PIT4362001:Atad5 UTSW 11 80111567 missense probably benign 0.04
R0040:Atad5 UTSW 11 80098014 missense probably benign
R0157:Atad5 UTSW 11 80089817 missense possibly damaging 0.74
R0211:Atad5 UTSW 11 80095647 missense probably benign 0.00
R0211:Atad5 UTSW 11 80095647 missense probably benign 0.00
R0319:Atad5 UTSW 11 80120790 splice site probably benign
R0401:Atad5 UTSW 11 80120699 missense probably benign 0.11
R0426:Atad5 UTSW 11 80112832 missense probably benign 0.14
R0452:Atad5 UTSW 11 80106421 missense probably damaging 0.98
R0496:Atad5 UTSW 11 80100356 missense probably benign 0.08
R1691:Atad5 UTSW 11 80095532 missense probably benign 0.00
R1812:Atad5 UTSW 11 80133047 missense probably damaging 0.98
R2070:Atad5 UTSW 11 80098052 splice site probably null
R2071:Atad5 UTSW 11 80098052 splice site probably null
R2153:Atad5 UTSW 11 80106377 missense probably benign 0.04
R2415:Atad5 UTSW 11 80094251 missense probably damaging 1.00
R3917:Atad5 UTSW 11 80103294 missense probably null 0.97
R4025:Atad5 UTSW 11 80120686 missense probably damaging 1.00
R4464:Atad5 UTSW 11 80100311 splice site probably null
R4561:Atad5 UTSW 11 80095889 missense probably benign 0.01
R4579:Atad5 UTSW 11 80095191 missense probably damaging 1.00
R4844:Atad5 UTSW 11 80114311 splice site probably null
R4853:Atad5 UTSW 11 80095272 missense probably damaging 1.00
R4873:Atad5 UTSW 11 80120689 missense probably damaging 1.00
R4875:Atad5 UTSW 11 80120689 missense probably damaging 1.00
R5054:Atad5 UTSW 11 80094676 missense probably benign 0.10
R5226:Atad5 UTSW 11 80095062 missense probably damaging 0.99
R5397:Atad5 UTSW 11 80111493 missense probably damaging 1.00
R5449:Atad5 UTSW 11 80124108 missense probably damaging 1.00
R5571:Atad5 UTSW 11 80111556 missense probably benign 0.05
R5575:Atad5 UTSW 11 80100323 missense probably benign 0.02
R5857:Atad5 UTSW 11 80131329 missense probably benign 0.06
R5927:Atad5 UTSW 11 80127285 missense probably damaging 1.00
R5928:Atad5 UTSW 11 80094177 missense probably damaging 1.00
R5949:Atad5 UTSW 11 80096009 nonsense probably null
R6102:Atad5 UTSW 11 80111572 critical splice donor site probably null
R6254:Atad5 UTSW 11 80127389 missense probably damaging 0.96
R6562:Atad5 UTSW 11 80133206 missense probably benign 0.26
R6744:Atad5 UTSW 11 80134032 missense probably benign 0.00
R7092:Atad5 UTSW 11 80120720 missense possibly damaging 0.68
R7202:Atad5 UTSW 11 80089775 missense probably damaging 1.00
R7345:Atad5 UTSW 11 80096006 missense probably damaging 1.00
R7352:Atad5 UTSW 11 80103343 critical splice donor site probably null
R7358:Atad5 UTSW 11 80133036 missense probably benign 0.32
R7420:Atad5 UTSW 11 80095862 missense probably benign 0.06
R7453:Atad5 UTSW 11 80119143 critical splice donor site probably null
R7990:Atad5 UTSW 11 80133253 nonsense probably null
R8012:Atad5 UTSW 11 80094240 missense probably damaging 1.00
R8152:Atad5 UTSW 11 80095170 missense possibly damaging 0.59
R8842:Atad5 UTSW 11 80110084 missense possibly damaging 0.87
R8918:Atad5 UTSW 11 80095647 missense probably benign 0.02
R8943:Atad5 UTSW 11 80095698 missense possibly damaging 0.86
R8944:Atad5 UTSW 11 80095698 missense possibly damaging 0.86
RF003:Atad5 UTSW 11 80111560 missense probably damaging 0.99
X0024:Atad5 UTSW 11 80132783 missense probably benign 0.02
Z1176:Atad5 UTSW 11 80094896 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGTAAGACGCCATTGGAAG -3'
(R):5'- AGTCAGCTTGCTGTCTTTGC -3'

Sequencing Primer
(F):5'- AGACGCCATTGGAAGTATTCTC -3'
(R):5'- CAGACTAAGTTCATCTGCTAAGGGC -3'
Posted On2020-10-20