Incidental Mutation 'R8421:Ankrd40'
ID653212
Institutional Source Beutler Lab
Gene Symbol Ankrd40
Ensembl Gene ENSMUSG00000020864
Gene Nameankyrin repeat domain 40
Synonyms1110011C06Rik, 5530600A18Rik, Gcap15
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R8421 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location94328001-94341841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 94334836 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 231 (G231V)
Ref Sequence ENSEMBL: ENSMUSP00000061637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021227] [ENSMUST00000051221] [ENSMUST00000107818] [ENSMUST00000149867]
Predicted Effect probably damaging
Transcript: ENSMUST00000021227
AA Change: G231V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021227
Gene: ENSMUSG00000020864
AA Change: G231V

DomainStartEndE-ValueType
ANK 9 38 7.29e2 SMART
ANK 43 72 3.57e-6 SMART
low complexity region 144 168 N/A INTRINSIC
low complexity region 234 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000051221
AA Change: G231V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061637
Gene: ENSMUSG00000020864
AA Change: G231V

DomainStartEndE-ValueType
ANK 9 38 7.29e2 SMART
ANK 43 72 3.57e-6 SMART
low complexity region 144 168 N/A INTRINSIC
low complexity region 234 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107818
AA Change: G231V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103448
Gene: ENSMUSG00000020864
AA Change: G231V

DomainStartEndE-ValueType
ANK 9 38 7.29e2 SMART
ANK 43 72 3.57e-6 SMART
low complexity region 144 168 N/A INTRINSIC
low complexity region 234 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149867
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,218,610 K275* probably null Het
Acin1 T C 14: 54,643,029 E1239G unknown Het
Actn3 T C 19: 4,861,713 M806V probably benign Het
Adcy7 A G 8: 88,322,184 T676A probably benign Het
Ankef1 C A 2: 136,537,165 Q12K probably damaging Het
Atad5 T A 11: 80,094,558 V157D probably damaging Het
Atp6v1b1 T A 6: 83,753,809 M163K probably damaging Het
Atp7b A T 8: 22,028,471 M117K probably benign Het
Ccdc87 T C 19: 4,841,285 Y602H possibly damaging Het
Cdh16 C T 8: 104,621,970 R142K probably benign Het
Chrnb3 G A 8: 27,396,690 V431I probably damaging Het
Csf1r A G 18: 61,127,894 D719G probably damaging Het
Ctsll3 A G 13: 60,800,781 F88S probably damaging Het
Dglucy A G 12: 100,842,679 Y212C probably damaging Het
Dnase1l3 T C 14: 7,968,122 D261G possibly damaging Het
Dync2h1 T C 9: 7,102,477 D2641G probably damaging Het
E330021D16Rik T C 6: 136,401,352 E160G probably damaging Het
Fat3 A T 9: 15,998,184 V2174D probably damaging Het
Gtf3c1 A G 7: 125,698,970 L244P probably damaging Het
Hcn4 T A 9: 58,858,096 D620E unknown Het
Ide A G 19: 37,278,004 V800A Het
Ikbkb A T 8: 22,678,788 probably null Het
Lin9 T A 1: 180,665,800 F197Y probably damaging Het
Lrp1b T A 2: 40,725,423 Y3656F Het
Mapkbp1 C A 2: 120,018,950 N708K probably damaging Het
Marveld3 A G 8: 109,948,647 M179T probably benign Het
Mrpl1 C G 5: 96,226,367 A167G probably benign Het
Mrpl35 T C 6: 71,816,167 K167E probably damaging Het
Myo3a T C 2: 22,362,124 V594A probably benign Het
Nav2 A G 7: 49,452,521 T356A probably benign Het
Nup210l A G 3: 90,203,867 Y1692C probably damaging Het
Olfr1054 T A 2: 86,332,903 Y151F possibly damaging Het
Otoa G A 7: 121,099,268 probably null Het
Oxnad1 T G 14: 32,099,474 I172S probably benign Het
Padi4 C A 4: 140,748,222 C544F probably damaging Het
Pard3 A C 8: 127,140,408 probably benign Het
Plvap G A 8: 71,511,532 T62M probably damaging Het
Prdm8 C T 5: 98,185,963 A463V probably damaging Het
Prss21 T A 17: 23,869,368 D102E possibly damaging Het
Psmb10 G T 8: 105,936,710 Q182K probably benign Het
Rasgrf1 C T 9: 89,967,915 P319S probably damaging Het
Rock1 G A 18: 10,072,863 Q1161* probably null Het
Ryr3 T C 2: 112,996,584 E112G probably benign Het
Samm50 A G 15: 84,210,585 T393A probably benign Het
Slc9c1 A G 16: 45,593,371 E954G probably damaging Het
Sulf2 T A 2: 166,117,052 I79F probably benign Het
Tbx21 T C 11: 97,114,735 K135E probably benign Het
Unc13b A G 4: 43,178,304 E3044G unknown Het
Usf3 A T 16: 44,217,209 Q684L possibly damaging Het
Vmn1r114 A T 7: 20,811,534 M218K possibly damaging Het
Vmn1r203 T G 13: 22,524,984 *312G probably null Het
Vmn2r67 A C 7: 85,136,685 L704R probably damaging Het
Zfp618 A G 4: 63,133,246 T755A probably damaging Het
Zp3 A G 5: 135,988,477 T381A probably benign Het
Zscan20 T C 4: 128,585,827 D957G probably damaging Het
Other mutations in Ankrd40
AlleleSourceChrCoordTypePredicted EffectPPH Score
G1patch:Ankrd40 UTSW 11 94334815 missense probably benign 0.01
R0621:Ankrd40 UTSW 11 94339607 splice site probably null
R2873:Ankrd40 UTSW 11 94333945 missense possibly damaging 0.62
R4817:Ankrd40 UTSW 11 94339633 missense probably benign 0.00
R4931:Ankrd40 UTSW 11 94334821 missense probably benign 0.41
R5026:Ankrd40 UTSW 11 94339724 unclassified probably benign
R5504:Ankrd40 UTSW 11 94328327 missense probably benign 0.31
R5891:Ankrd40 UTSW 11 94334863 missense probably damaging 1.00
R6089:Ankrd40 UTSW 11 94333925 missense probably damaging 1.00
R6725:Ankrd40 UTSW 11 94334815 missense probably benign 0.01
R7789:Ankrd40 UTSW 11 94334709 missense probably damaging 1.00
R8179:Ankrd40 UTSW 11 94334715 missense probably benign 0.00
R8376:Ankrd40 UTSW 11 94334836 missense probably damaging 1.00
R8378:Ankrd40 UTSW 11 94334836 missense probably damaging 1.00
R8419:Ankrd40 UTSW 11 94334836 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAAACCCCTTTGCTAGG -3'
(R):5'- GGAATCTTGAGTGTAAAGAGTTCC -3'

Sequencing Primer
(F):5'- CTTTCCTAGGGACCACAGC -3'
(R):5'- GAGTTCCTTCATTAGACAGATCTTGG -3'
Posted On2020-10-20