Incidental Mutation 'R8421:Samm50'
ID 653220
Institutional Source Beutler Lab
Gene Symbol Samm50
Ensembl Gene ENSMUSG00000022437
Gene Name SAMM50 sorting and assembly machinery component
Synonyms 1110030L07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock # R8421 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 84192241-84217267 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84210585 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 393 (T393A)
Ref Sequence ENSEMBL: ENSMUSP00000023071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023071]
AlphaFold Q8BGH2
Predicted Effect probably benign
Transcript: ENSMUST00000023071
AA Change: T393A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000023071
Gene: ENSMUSG00000022437
AA Change: T393A

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
Pfam:Bac_surface_Ag 151 468 1.8e-68 PFAM
Meta Mutation Damage Score 0.1072 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the Sorting and Assembly Machinery (SAM) of the mitochondrial outer membrane. The Sam complex functions in the assembly of beta-barrel proteins into the outer mitochondrial membrane.[provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,218,610 K275* probably null Het
Acin1 T C 14: 54,643,029 E1239G unknown Het
Actn3 T C 19: 4,861,713 M806V probably benign Het
Adcy7 A G 8: 88,322,184 T676A probably benign Het
Ankef1 C A 2: 136,537,165 Q12K probably damaging Het
Ankrd40 G T 11: 94,334,836 G231V probably damaging Het
Atad5 T A 11: 80,094,558 V157D probably damaging Het
Atp6v1b1 T A 6: 83,753,809 M163K probably damaging Het
Atp7b A T 8: 22,028,471 M117K probably benign Het
Ccdc87 T C 19: 4,841,285 Y602H possibly damaging Het
Cdh16 C T 8: 104,621,970 R142K probably benign Het
Chrnb3 G A 8: 27,396,690 V431I probably damaging Het
Csf1r A G 18: 61,127,894 D719G probably damaging Het
Ctsll3 A G 13: 60,800,781 F88S probably damaging Het
Dglucy A G 12: 100,842,679 Y212C probably damaging Het
Dnase1l3 T C 14: 7,968,122 D261G possibly damaging Het
Dync2h1 T C 9: 7,102,477 D2641G probably damaging Het
E330021D16Rik T C 6: 136,401,352 E160G probably damaging Het
Fat3 A T 9: 15,998,184 V2174D probably damaging Het
Gtf3c1 A G 7: 125,698,970 L244P probably damaging Het
Hcn4 T A 9: 58,858,096 D620E unknown Het
Ide A G 19: 37,278,004 V800A Het
Ikbkb A T 8: 22,678,788 probably null Het
Lin9 T A 1: 180,665,800 F197Y probably damaging Het
Lrp1b T A 2: 40,725,423 Y3656F Het
Mapkbp1 C A 2: 120,018,950 N708K probably damaging Het
Marveld3 A G 8: 109,948,647 M179T probably benign Het
Mrpl1 C G 5: 96,226,367 A167G probably benign Het
Mrpl35 T C 6: 71,816,167 K167E probably damaging Het
Myo3a T C 2: 22,362,124 V594A probably benign Het
Nav2 A G 7: 49,452,521 T356A probably benign Het
Nup210l A G 3: 90,203,867 Y1692C probably damaging Het
Olfr1054 T A 2: 86,332,903 Y151F possibly damaging Het
Otoa G A 7: 121,099,268 probably null Het
Oxnad1 T G 14: 32,099,474 I172S probably benign Het
Padi4 C A 4: 140,748,222 C544F probably damaging Het
Pard3 A C 8: 127,140,408 probably benign Het
Plvap G A 8: 71,511,532 T62M probably damaging Het
Prdm8 C T 5: 98,185,963 A463V probably damaging Het
Prss21 T A 17: 23,869,368 D102E possibly damaging Het
Psmb10 G T 8: 105,936,710 Q182K probably benign Het
Rasgrf1 C T 9: 89,967,915 P319S probably damaging Het
Rock1 G A 18: 10,072,863 Q1161* probably null Het
Ryr3 T C 2: 112,996,584 E112G probably benign Het
Slc9c1 A G 16: 45,593,371 E954G probably damaging Het
Sulf2 T A 2: 166,117,052 I79F probably benign Het
Tbx21 T C 11: 97,114,735 K135E probably benign Het
Unc13b A G 4: 43,178,304 E3044G unknown Het
Usf3 A T 16: 44,217,209 Q684L possibly damaging Het
Vmn1r114 A T 7: 20,811,534 M218K possibly damaging Het
Vmn1r203 T G 13: 22,524,984 *312G probably null Het
Vmn2r67 A C 7: 85,136,685 L704R probably damaging Het
Zfp618 A G 4: 63,133,246 T755A probably damaging Het
Zp3 A G 5: 135,988,477 T381A probably benign Het
Zscan20 T C 4: 128,585,827 D957G probably damaging Het
Other mutations in Samm50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Samm50 APN 15 84200375 missense possibly damaging 0.82
IGL01061:Samm50 APN 15 84202254 missense probably benign 0.00
IGL01549:Samm50 APN 15 84202781 missense probably benign
IGL01586:Samm50 APN 15 84195838 missense probably benign 0.03
IGL02494:Samm50 APN 15 84195814 missense probably benign
IGL02607:Samm50 APN 15 84207838 missense probably benign 0.09
IGL03244:Samm50 APN 15 84214140 missense probably benign 0.09
IGL03340:Samm50 APN 15 84198663 critical splice donor site probably null
R0591:Samm50 UTSW 15 84211168 missense probably benign
R0634:Samm50 UTSW 15 84214171 synonymous silent
R1780:Samm50 UTSW 15 84211127 missense probably damaging 0.99
R2192:Samm50 UTSW 15 84200424 critical splice donor site probably null
R2205:Samm50 UTSW 15 84202314 missense probably benign 0.01
R3800:Samm50 UTSW 15 84192374 missense probably damaging 0.99
R4285:Samm50 UTSW 15 84197012 missense probably damaging 1.00
R4333:Samm50 UTSW 15 84202830 missense probably benign 0.02
R4780:Samm50 UTSW 15 84210610 missense possibly damaging 0.88
R5223:Samm50 UTSW 15 84200630 missense probably benign 0.07
R5639:Samm50 UTSW 15 84214128 missense probably benign 0.22
R6258:Samm50 UTSW 15 84200311 missense probably damaging 1.00
R6258:Samm50 UTSW 15 84200312 missense probably damaging 0.98
R6437:Samm50 UTSW 15 84204097 critical splice donor site probably null
R6452:Samm50 UTSW 15 84204097 critical splice donor site probably benign
R6715:Samm50 UTSW 15 84211058 missense probably benign
R6957:Samm50 UTSW 15 84198649 missense probably damaging 1.00
R7409:Samm50 UTSW 15 84197030 missense probably benign 0.32
R7459:Samm50 UTSW 15 84195856 critical splice donor site probably null
R7706:Samm50 UTSW 15 84200880 splice site probably null
R7910:Samm50 UTSW 15 84214145 missense possibly damaging 0.49
R8443:Samm50 UTSW 15 84210501 missense possibly damaging 0.82
R9339:Samm50 UTSW 15 84211075 missense probably benign 0.00
X0067:Samm50 UTSW 15 84202833 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATCATGGAAGGATCCTGTAAAGG -3'
(R):5'- TGTGAGCATCCTCTGGACAG -3'

Sequencing Primer
(F):5'- TCCTGTAAAGGAGAGAGGCTG -3'
(R):5'- GACAGAGCTGTGCTGAGC -3'
Posted On 2020-10-20