Incidental Mutation 'R8421:Slc9c1'
ID 653222
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, spermNHE, Slc9a10
MMRRC Submission 067898-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R8421 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 45355672-45427364 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45413734 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 954 (E954G)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect probably damaging
Transcript: ENSMUST00000159945
AA Change: E954G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: E954G

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,880,486 (GRCm39) E1239G unknown Het
Actn3 T C 19: 4,911,741 (GRCm39) M806V probably benign Het
Adcy7 A G 8: 89,048,812 (GRCm39) T676A probably benign Het
Ankef1 C A 2: 136,379,085 (GRCm39) Q12K probably damaging Het
Ankrd40 G T 11: 94,225,662 (GRCm39) G231V probably damaging Het
Atad5 T A 11: 79,985,384 (GRCm39) V157D probably damaging Het
Atp6v1b1 T A 6: 83,730,791 (GRCm39) M163K probably damaging Het
Atp7b A T 8: 22,518,487 (GRCm39) M117K probably benign Het
Ccdc87 T C 19: 4,891,313 (GRCm39) Y602H possibly damaging Het
Cdh16 C T 8: 105,348,602 (GRCm39) R142K probably benign Het
Chrnb3 G A 8: 27,886,718 (GRCm39) V431I probably damaging Het
Csf1r A G 18: 61,260,966 (GRCm39) D719G probably damaging Het
Ctsll3 A G 13: 60,948,595 (GRCm39) F88S probably damaging Het
Dglucy A G 12: 100,808,938 (GRCm39) Y212C probably damaging Het
Dnase1l3 T C 14: 7,968,122 (GRCm38) D261G possibly damaging Het
Dync2h1 T C 9: 7,102,477 (GRCm39) D2641G probably damaging Het
Fat3 A T 9: 15,909,480 (GRCm39) V2174D probably damaging Het
Gtf3c1 A G 7: 125,298,142 (GRCm39) L244P probably damaging Het
Hcn4 T A 9: 58,765,379 (GRCm39) D620E unknown Het
Ide A G 19: 37,255,403 (GRCm39) V800A Het
Ikbkb A T 8: 23,168,804 (GRCm39) probably null Het
Lin9 T A 1: 180,493,365 (GRCm39) F197Y probably damaging Het
Lrp1b T A 2: 40,615,435 (GRCm39) Y3656F Het
Mapkbp1 C A 2: 119,849,431 (GRCm39) N708K probably damaging Het
Marveld3 A G 8: 110,675,279 (GRCm39) M179T probably benign Het
Mrpl1 C G 5: 96,374,226 (GRCm39) A167G probably benign Het
Mrpl35 T C 6: 71,793,151 (GRCm39) K167E probably damaging Het
Myo3a T C 2: 22,366,935 (GRCm39) V594A probably benign Het
Nav2 A G 7: 49,102,269 (GRCm39) T356A probably benign Het
Nup210l A G 3: 90,111,174 (GRCm39) Y1692C probably damaging Het
Or8k22 T A 2: 86,163,247 (GRCm39) Y151F possibly damaging Het
Otoa G A 7: 120,698,491 (GRCm39) probably null Het
Oxnad1 T G 14: 31,821,431 (GRCm39) I172S probably benign Het
Padi4 C A 4: 140,475,533 (GRCm39) C544F probably damaging Het
Pard3 A C 8: 127,867,158 (GRCm39) probably benign Het
Plvap G A 8: 71,964,176 (GRCm39) T62M probably damaging Het
Potefam1 T A 2: 111,048,955 (GRCm39) K275* probably null Het
Prdm8 C T 5: 98,333,822 (GRCm39) A463V probably damaging Het
Prss21 T A 17: 24,088,342 (GRCm39) D102E possibly damaging Het
Psmb10 G T 8: 106,663,342 (GRCm39) Q182K probably benign Het
Rasgrf1 C T 9: 89,849,968 (GRCm39) P319S probably damaging Het
Rock1 G A 18: 10,072,863 (GRCm39) Q1161* probably null Het
Ryr3 T C 2: 112,826,929 (GRCm39) E112G probably benign Het
Samm50 A G 15: 84,094,786 (GRCm39) T393A probably benign Het
Sulf2 T A 2: 165,958,972 (GRCm39) I79F probably benign Het
Tbx21 T C 11: 97,005,561 (GRCm39) K135E probably benign Het
Ube2q2l T C 6: 136,378,350 (GRCm39) E160G probably damaging Het
Unc13b A G 4: 43,178,304 (GRCm39) E3044G unknown Het
Usf3 A T 16: 44,037,572 (GRCm39) Q684L possibly damaging Het
Vmn1r114 A T 7: 20,545,459 (GRCm39) M218K possibly damaging Het
Vmn1r203 T G 13: 22,709,154 (GRCm39) *312G probably null Het
Vmn2r67 A C 7: 84,785,893 (GRCm39) L704R probably damaging Het
Zfp618 A G 4: 63,051,483 (GRCm39) T755A probably damaging Het
Zp3 A G 5: 136,017,331 (GRCm39) T381A probably benign Het
Zscan20 T C 4: 128,479,620 (GRCm39) D957G probably damaging Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45,393,752 (GRCm39) missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45,360,002 (GRCm39) missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45,413,721 (GRCm39) missense probably benign
IGL01287:Slc9c1 APN 16 45,404,811 (GRCm39) nonsense probably null
IGL01536:Slc9c1 APN 16 45,409,992 (GRCm39) critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45,403,335 (GRCm39) missense probably benign
IGL01671:Slc9c1 APN 16 45,380,678 (GRCm39) missense probably benign
IGL01720:Slc9c1 APN 16 45,376,132 (GRCm39) missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45,361,824 (GRCm39) missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45,419,833 (GRCm39) missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45,376,977 (GRCm39) missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45,400,505 (GRCm39) missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45,398,238 (GRCm39) missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45,370,548 (GRCm39) missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45,401,961 (GRCm39) missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45,395,782 (GRCm39) missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45,363,624 (GRCm39) splice site probably benign
IGL03062:Slc9c1 APN 16 45,420,121 (GRCm39) missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45,368,003 (GRCm39) missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45,363,531 (GRCm39) missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45,370,524 (GRCm39) missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45,427,219 (GRCm39) utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45,395,783 (GRCm39) missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45,374,663 (GRCm39) missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45,400,595 (GRCm39) missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45,420,250 (GRCm39) splice site probably benign
R0611:Slc9c1 UTSW 16 45,401,965 (GRCm39) missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45,393,719 (GRCm39) missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45,363,483 (GRCm39) splice site probably benign
R1106:Slc9c1 UTSW 16 45,376,170 (GRCm39) missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45,422,324 (GRCm39) missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45,373,291 (GRCm39) missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45,409,872 (GRCm39) missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45,374,652 (GRCm39) missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45,378,644 (GRCm39) missense probably benign
R1813:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45,413,835 (GRCm39) missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45,370,469 (GRCm39) missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45,374,618 (GRCm39) missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45,400,613 (GRCm39) missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45,413,827 (GRCm39) missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45,365,099 (GRCm39) missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45,400,582 (GRCm39) missense probably benign
R3765:Slc9c1 UTSW 16 45,411,244 (GRCm39) missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45,427,193 (GRCm39) utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45,363,593 (GRCm39) missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45,365,154 (GRCm39) missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45,419,829 (GRCm39) missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45,367,756 (GRCm39) makesense probably null
R4928:Slc9c1 UTSW 16 45,395,772 (GRCm39) missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45,365,194 (GRCm39) missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45,413,800 (GRCm39) missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45,374,609 (GRCm39) missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45,376,977 (GRCm39) missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45,365,123 (GRCm39) missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45,368,031 (GRCm39) missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45,395,731 (GRCm39) missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45,376,132 (GRCm39) missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45,427,204 (GRCm39) utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45,398,194 (GRCm39) missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45,370,479 (GRCm39) missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45,401,878 (GRCm39) missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45,413,847 (GRCm39) missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45,398,256 (GRCm39) missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45,403,332 (GRCm39) missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45,360,076 (GRCm39) missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45,403,344 (GRCm39) missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45,368,058 (GRCm39) missense probably benign
R8328:Slc9c1 UTSW 16 45,398,227 (GRCm39) missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45,427,182 (GRCm39) missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45,380,646 (GRCm39) missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45,400,490 (GRCm39) missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45,420,144 (GRCm39) missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45,398,275 (GRCm39) missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45,370,551 (GRCm39) missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45,413,848 (GRCm39) missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45,395,770 (GRCm39) missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45,380,705 (GRCm39) missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45,400,577 (GRCm39) missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45,368,026 (GRCm39) missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45,400,616 (GRCm39) missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45,398,262 (GRCm39) missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45,378,601 (GRCm39) missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45,393,782 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTGTGGGAAAGTCACTGCTC -3'
(R):5'- CCCTTAGGCACATGCTAAGCAC -3'

Sequencing Primer
(F):5'- GGGAAAGTCACTGCTCATTTAATAAC -3'
(R):5'- TTAGGCACATGCTAAGCACTAAAAAC -3'
Posted On 2020-10-20