Incidental Mutation 'R8421:Slc9c1'
ID653222
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Namesolute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
SynonymsLOC208169, Slc9a10, spermNHE
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R8421 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location45535309-45607001 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45593371 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 954 (E954G)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
Predicted Effect probably damaging
Transcript: ENSMUST00000159945
AA Change: E954G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: E954G

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,218,610 K275* probably null Het
Acin1 T C 14: 54,643,029 E1239G unknown Het
Actn3 T C 19: 4,861,713 M806V probably benign Het
Adcy7 A G 8: 88,322,184 T676A probably benign Het
Ankef1 C A 2: 136,537,165 Q12K probably damaging Het
Ankrd40 G T 11: 94,334,836 G231V probably damaging Het
Atad5 T A 11: 80,094,558 V157D probably damaging Het
Atp6v1b1 T A 6: 83,753,809 M163K probably damaging Het
Atp7b A T 8: 22,028,471 M117K probably benign Het
Ccdc87 T C 19: 4,841,285 Y602H possibly damaging Het
Cdh16 C T 8: 104,621,970 R142K probably benign Het
Chrnb3 G A 8: 27,396,690 V431I probably damaging Het
Csf1r A G 18: 61,127,894 D719G probably damaging Het
Ctsll3 A G 13: 60,800,781 F88S probably damaging Het
Dglucy A G 12: 100,842,679 Y212C probably damaging Het
Dnase1l3 T C 14: 7,968,122 D261G possibly damaging Het
Dync2h1 T C 9: 7,102,477 D2641G probably damaging Het
E330021D16Rik T C 6: 136,401,352 E160G probably damaging Het
Fat3 A T 9: 15,998,184 V2174D probably damaging Het
Gtf3c1 A G 7: 125,698,970 L244P probably damaging Het
Hcn4 T A 9: 58,858,096 D620E unknown Het
Ide A G 19: 37,278,004 V800A Het
Ikbkb A T 8: 22,678,788 probably null Het
Lin9 T A 1: 180,665,800 F197Y probably damaging Het
Lrp1b T A 2: 40,725,423 Y3656F Het
Mapkbp1 C A 2: 120,018,950 N708K probably damaging Het
Marveld3 A G 8: 109,948,647 M179T probably benign Het
Mrpl1 C G 5: 96,226,367 A167G probably benign Het
Mrpl35 T C 6: 71,816,167 K167E probably damaging Het
Myo3a T C 2: 22,362,124 V594A probably benign Het
Nav2 A G 7: 49,452,521 T356A probably benign Het
Nup210l A G 3: 90,203,867 Y1692C probably damaging Het
Olfr1054 T A 2: 86,332,903 Y151F possibly damaging Het
Olfr1437 T A 19: 12,322,612 I72F probably benign Het
Otoa G A 7: 121,099,268 probably null Het
Oxnad1 T G 14: 32,099,474 I172S probably benign Het
Padi4 C A 4: 140,748,222 C544F probably damaging Het
Plvap G A 8: 71,511,532 T62M probably damaging Het
Prdm8 C T 5: 98,185,963 A463V probably damaging Het
Prss21 T A 17: 23,869,368 D102E possibly damaging Het
Psmb10 G T 8: 105,936,710 Q182K probably benign Het
Rasgrf1 C T 9: 89,967,915 P319S probably damaging Het
Rock1 G A 18: 10,072,863 Q1161* probably null Het
Ryr3 T C 2: 112,996,584 E112G probably benign Het
Samm50 A G 15: 84,210,585 T393A probably benign Het
Sulf2 T A 2: 166,117,052 I79F probably benign Het
Tbx21 T C 11: 97,114,735 K135E probably benign Het
Unc13b A G 4: 43,178,304 E3044G unknown Het
Usf3 A T 16: 44,217,209 Q684L possibly damaging Het
Vmn1r114 A T 7: 20,811,534 M218K possibly damaging Het
Vmn1r203 T G 13: 22,524,984 *312G probably null Het
Vmn2r67 A C 7: 85,136,685 L704R probably damaging Het
Zfp618 A G 4: 63,133,246 T755A probably damaging Het
Zp3 A G 5: 135,988,477 T381A probably benign Het
Zscan20 T C 4: 128,585,827 D957G probably damaging Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45573389 missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45539639 missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45593358 missense probably benign
IGL01287:Slc9c1 APN 16 45584448 nonsense probably null
IGL01536:Slc9c1 APN 16 45589629 critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45582972 missense probably benign
IGL01671:Slc9c1 APN 16 45560315 missense probably benign
IGL01720:Slc9c1 APN 16 45555769 missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45541461 missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45599470 missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45556614 missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45580142 missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45577875 missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45550185 missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45581598 missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45575419 missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45543261 splice site probably benign
IGL03062:Slc9c1 APN 16 45599758 missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45547640 missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45543168 missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45550161 missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45606856 utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45575420 missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45554300 missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45580232 missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45599887 splice site probably benign
R0611:Slc9c1 UTSW 16 45581602 missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45573356 missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45543120 splice site probably benign
R1106:Slc9c1 UTSW 16 45555807 missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45601961 missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45552928 missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45589509 missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45554289 missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45558281 missense probably benign
R1813:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45593472 missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45550106 missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45554255 missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45580250 missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45593464 missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45544736 missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45580219 missense probably benign
R3765:Slc9c1 UTSW 16 45590881 missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45606830 utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45543230 missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45544791 missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45599466 missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45547393 makesense probably null
R4928:Slc9c1 UTSW 16 45575409 missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45544831 missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45593437 missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45554246 missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45556614 missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45544760 missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45547668 missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45575368 missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45555769 missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45606841 utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45577831 missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45550116 missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45581515 missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45593484 missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45577893 missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45582969 missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45539713 missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45582981 missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45547695 missense probably benign
R8328:Slc9c1 UTSW 16 45577864 missense probably damaging 0.97
V8831:Slc9c1 UTSW 16 45577899 missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45558238 missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45573419 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTGTGGGAAAGTCACTGCTC -3'
(R):5'- CCCTTAGGCACATGCTAAGCAC -3'

Sequencing Primer
(F):5'- GGGAAAGTCACTGCTCATTTAATAAC -3'
(R):5'- TTAGGCACATGCTAAGCACTAAAAAC -3'
Posted On2020-10-20