Incidental Mutation 'R8422:Dis3l2'
ID 653231
Institutional Source Beutler Lab
Gene Symbol Dis3l2
Ensembl Gene ENSMUSG00000053333
Gene Name DIS3 like 3'-5' exoribonuclease 2
Synonyms 4930429A22Rik, 8030493P09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock # R8422 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 86703808-87050095 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86854377 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 219 (T219A)
Ref Sequence ENSEMBL: ENSMUSP00000132673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065694] [ENSMUST00000168237] [ENSMUST00000190618]
AlphaFold Q8CI75
Predicted Effect probably benign
Transcript: ENSMUST00000065694
AA Change: T205A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070506
Gene: ENSMUSG00000053333
AA Change: T205A

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
RNB 369 719 8.9e-140 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168237
AA Change: T219A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132673
Gene: ENSMUSG00000053333
AA Change: T219A

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
RNB 383 733 8.9e-140 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190618
SMART Domains Protein: ENSMUSP00000139579
Gene: ENSMUSG00000053333

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
PDB:2VNU|D 50 123 4e-10 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence to 3'/5' exonucleolytic subunits of the RNA exosome. The exosome is a large multimeric ribonucleotide complex responsible for degrading various RNA substrates. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,662,297 S570R possibly damaging Het
4921517D22Rik T C 13: 59,691,629 M1V probably null Het
4921524J17Rik T G 8: 85,412,289 K57T possibly damaging Het
4930596D02Rik G T 14: 35,810,052 Q189K probably benign Het
Anapc1 T C 2: 128,675,837 T296A probably benign Het
Aqp7 T A 4: 41,035,622 M78L probably benign Het
C1qtnf5 C A 9: 44,108,664 A195E possibly damaging Het
Calhm2 T C 19: 47,133,140 I197V probably benign Het
Ccdc186 G A 19: 56,813,185 L167F probably benign Het
Ccr3 T C 9: 124,028,762 Y45H probably damaging Het
Cct3 G C 3: 88,300,819 R38P probably damaging Het
Clstn2 T C 9: 97,458,186 D711G probably benign Het
Dab2ip T A 2: 35,707,755 I157N probably damaging Het
Dchs2 T C 3: 83,325,263 V2185A probably benign Het
F2rl3 G T 8: 72,763,185 V347L probably benign Het
Fastkd1 A G 2: 69,702,434 S530P probably damaging Het
Fgfr3 T A 5: 33,734,905 Y689* probably null Het
Gm10521 A G 1: 171,896,459 I112M unknown Het
Gm9736 C A 10: 77,750,880 V159F unknown Het
Hba-x A T 11: 32,277,736 H88L probably benign Het
Il12rb2 A T 6: 67,360,816 V27E probably benign Het
Imp4 G T 1: 34,443,916 G196V probably damaging Het
Itga11 A C 9: 62,767,678 I831L probably benign Het
Macf1 C T 4: 123,409,486 V408I possibly damaging Het
Nedd4 T A 9: 72,742,682 D771E probably damaging Het
Noc3l T C 19: 38,807,103 Y413C probably benign Het
Npas3 C A 12: 54,068,509 T738K probably benign Het
Ntrk2 A T 13: 58,985,901 D498V probably damaging Het
Nyap1 T C 5: 137,735,821 T317A probably benign Het
Olfr1212 T C 2: 88,958,997 M177T probably benign Het
Olfr294 T A 7: 86,616,258 H129L probably benign Het
Olfr74 T A 2: 87,973,799 I289L probably benign Het
Olfr978 T C 9: 39,994,554 L248P probably damaging Het
Pcdhb20 A T 18: 37,504,796 D125V probably damaging Het
Phc3 G A 3: 30,929,890 Q692* probably null Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Ppp1r12a T A 10: 108,241,181 H339Q probably benign Het
Ppp1r3a G A 6: 14,718,435 Q827* probably null Het
Ptpra T A 2: 130,532,171 I265N possibly damaging Het
Rabggta G T 14: 55,718,458 H447Q probably benign Het
Ralgps1 T C 2: 33,172,430 D277G possibly damaging Het
Riok3 A T 18: 12,136,812 E100V probably null Het
Rtcb C T 10: 85,943,304 V362M probably benign Het
Scd2 G T 19: 44,301,304 C246F probably benign Het
Slco6c1 T C 1: 97,125,783 E131G probably damaging Het
Tanc2 A G 11: 105,835,188 M393V probably benign Het
Tas2r136 A T 6: 132,777,327 I279N probably damaging Het
Tbx3 G T 5: 119,680,516 K405N possibly damaging Het
Thumpd2 A T 17: 81,026,944 V405D probably damaging Het
Tlr12 A G 4: 128,616,634 S608P probably damaging Het
Wfs1 T C 5: 36,973,875 K165E probably benign Het
Zfp810 C A 9: 22,283,222 E57* probably null Het
Other mutations in Dis3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Dis3l2 APN 1 86857203 missense probably benign 0.00
IGL01607:Dis3l2 APN 1 86745487 missense probably benign 0.04
IGL02233:Dis3l2 APN 1 86990231 missense probably damaging 1.00
IGL02698:Dis3l2 APN 1 87048829 splice site probably benign
R0514:Dis3l2 UTSW 1 87047092 missense probably damaging 1.00
R0893:Dis3l2 UTSW 1 87044206 splice site probably null
R1086:Dis3l2 UTSW 1 86990149 missense probably benign 0.36
R1140:Dis3l2 UTSW 1 86821438 missense probably benign 0.00
R1509:Dis3l2 UTSW 1 87021086 missense possibly damaging 0.91
R2029:Dis3l2 UTSW 1 86854467 splice site probably benign
R2511:Dis3l2 UTSW 1 86990258 missense probably benign 0.05
R3772:Dis3l2 UTSW 1 86854408 missense probably benign
R4163:Dis3l2 UTSW 1 86821237 missense probably benign 0.00
R4547:Dis3l2 UTSW 1 87049671 missense probably benign 0.00
R4548:Dis3l2 UTSW 1 87049671 missense probably benign 0.00
R4650:Dis3l2 UTSW 1 86990321 missense possibly damaging 0.83
R4810:Dis3l2 UTSW 1 87047574 missense probably damaging 0.99
R4936:Dis3l2 UTSW 1 87044168 missense probably benign 0.00
R5010:Dis3l2 UTSW 1 86760321 missense probably benign 0.21
R5040:Dis3l2 UTSW 1 86857337 missense probably damaging 0.98
R5272:Dis3l2 UTSW 1 86973404 missense possibly damaging 0.72
R5500:Dis3l2 UTSW 1 87021119 critical splice donor site probably null
R5556:Dis3l2 UTSW 1 86973404 missense possibly damaging 0.72
R5772:Dis3l2 UTSW 1 86878432 missense probably damaging 1.00
R5808:Dis3l2 UTSW 1 87049638 missense possibly damaging 0.94
R5950:Dis3l2 UTSW 1 87021108 missense probably damaging 0.96
R6328:Dis3l2 UTSW 1 86854431 missense probably benign 0.05
R6553:Dis3l2 UTSW 1 86745494 missense probably damaging 1.00
R6585:Dis3l2 UTSW 1 86745494 missense probably damaging 1.00
R6905:Dis3l2 UTSW 1 87044839 missense probably benign 0.00
R6921:Dis3l2 UTSW 1 86857341 missense probably benign
R7162:Dis3l2 UTSW 1 87044030 missense possibly damaging 0.94
R7270:Dis3l2 UTSW 1 86990303 missense possibly damaging 0.49
R7438:Dis3l2 UTSW 1 86745500 critical splice donor site probably null
R8696:Dis3l2 UTSW 1 86791440 nonsense probably null
R9235:Dis3l2 UTSW 1 86821339 missense possibly damaging 0.95
R9291:Dis3l2 UTSW 1 86973493 missense possibly damaging 0.82
X0027:Dis3l2 UTSW 1 86760351 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGGCCTTATCCAAACCACTG -3'
(R):5'- GGTCCTACACCTGAAGATGC -3'

Sequencing Primer
(F):5'- TGCCCAACAGCTGCCTCTG -3'
(R):5'- AGTTACAGAAATCCTATCCATTTCCC -3'
Posted On 2020-10-20