Incidental Mutation 'R8422:Slco6c1'
ID653232
Institutional Source Beutler Lab
Gene Symbol Slco6c1
Ensembl Gene ENSMUSG00000026331
Gene Namesolute carrier organic anion transporter family, member 6c1
Synonyms4933404A18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8422 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location97059038-97128301 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97125783 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 131 (E131G)
Ref Sequence ENSEMBL: ENSMUSP00000027569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027569] [ENSMUST00000189547]
Predicted Effect probably damaging
Transcript: ENSMUST00000027569
AA Change: E131G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027569
Gene: ENSMUSG00000026331
AA Change: E131G

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
Pfam:OATP 95 654 3e-101 PFAM
Pfam:MFS_1 207 474 6.5e-14 PFAM
Pfam:Kazal_2 497 538 7.4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189547
AA Change: E131G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140791
Gene: ENSMUSG00000026331
AA Change: E131G

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
Pfam:OATP 93 197 7.4e-12 PFAM
Pfam:MFS_1 99 457 2.2e-15 PFAM
Pfam:OATP 192 638 2.5e-64 PFAM
Pfam:Kazal_2 480 521 2.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,662,297 S570R possibly damaging Het
4921517D22Rik T C 13: 59,691,629 M1V probably null Het
4921524J17Rik T G 8: 85,412,289 K57T possibly damaging Het
4930596D02Rik G T 14: 35,810,052 Q189K probably benign Het
Anapc1 T C 2: 128,675,837 T296A probably benign Het
Aqp7 T A 4: 41,035,622 M78L probably benign Het
C1qtnf5 C A 9: 44,108,664 A195E possibly damaging Het
Calhm2 T C 19: 47,133,140 I197V probably benign Het
Ccdc186 G A 19: 56,813,185 L167F probably benign Het
Ccr3 T C 9: 124,028,762 Y45H probably damaging Het
Cct3 G C 3: 88,300,819 R38P probably damaging Het
Clstn2 T C 9: 97,458,186 D711G probably benign Het
Dab2ip T A 2: 35,707,755 I157N probably damaging Het
Dchs2 T C 3: 83,325,263 V2185A probably benign Het
Dis3l2 A G 1: 86,854,377 T219A probably benign Het
F2rl3 G T 8: 72,763,185 V347L probably benign Het
Fastkd1 A G 2: 69,702,434 S530P probably damaging Het
Fgfr3 T A 5: 33,734,905 Y689* probably null Het
Gm10521 A G 1: 171,896,459 I112M unknown Het
Gm9736 C A 10: 77,750,880 V159F unknown Het
Hba-x A T 11: 32,277,736 H88L probably benign Het
Il12rb2 A T 6: 67,360,816 V27E probably benign Het
Imp4 G T 1: 34,443,916 G196V probably damaging Het
Itga11 A C 9: 62,767,678 I831L probably benign Het
Macf1 C T 4: 123,409,486 V408I possibly damaging Het
Nedd4 T A 9: 72,742,682 D771E probably damaging Het
Noc3l T C 19: 38,807,103 Y413C probably benign Het
Npas3 C A 12: 54,068,509 T738K probably benign Het
Ntrk2 A T 13: 58,985,901 D498V probably damaging Het
Nyap1 T C 5: 137,735,821 T317A probably benign Het
Olfr1212 T C 2: 88,958,997 M177T probably benign Het
Olfr294 T A 7: 86,616,258 H129L probably benign Het
Olfr74 T A 2: 87,973,799 I289L probably benign Het
Olfr978 T C 9: 39,994,554 L248P probably damaging Het
Pcdhb20 A T 18: 37,504,796 D125V probably damaging Het
Phc3 G A 3: 30,929,890 Q692* probably null Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Ppp1r12a T A 10: 108,241,181 H339Q probably benign Het
Ppp1r3a G A 6: 14,718,435 Q827* probably null Het
Ptpra T A 2: 130,532,171 I265N possibly damaging Het
Rabggta G T 14: 55,718,458 H447Q probably benign Het
Ralgps1 T C 2: 33,172,430 D277G possibly damaging Het
Riok3 A T 18: 12,136,812 E100V probably null Het
Rtcb C T 10: 85,943,304 V362M probably benign Het
Scd2 G T 19: 44,301,304 C246F probably benign Het
Tanc2 A G 11: 105,835,188 M393V probably benign Het
Tas2r136 A T 6: 132,777,327 I279N probably damaging Het
Tbx3 G T 5: 119,680,516 K405N possibly damaging Het
Thumpd2 A T 17: 81,026,944 V405D probably damaging Het
Tlr12 A G 4: 128,616,634 S608P probably damaging Het
Wfs1 T C 5: 36,973,875 K165E probably benign Het
Zfp810 C A 9: 22,283,222 E57* probably null Het
Other mutations in Slco6c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Slco6c1 APN 1 97087949 missense probably benign 0.00
IGL00571:Slco6c1 APN 1 97087951 missense probably benign 0.04
IGL01483:Slco6c1 APN 1 97128107 missense probably benign
IGL01543:Slco6c1 APN 1 97125828 missense possibly damaging 0.95
IGL01860:Slco6c1 APN 1 97075823 splice site probably benign
IGL03106:Slco6c1 APN 1 97066023 splice site probably benign
R0087:Slco6c1 UTSW 1 97118578 missense probably benign 0.00
R0543:Slco6c1 UTSW 1 97127898 missense probably damaging 0.99
R0674:Slco6c1 UTSW 1 97104773 splice site probably benign
R0826:Slco6c1 UTSW 1 97128101 missense probably benign 0.00
R0928:Slco6c1 UTSW 1 97104848 missense possibly damaging 0.88
R0969:Slco6c1 UTSW 1 97119960 missense probably benign 0.05
R1366:Slco6c1 UTSW 1 97128203 start gained probably null
R1559:Slco6c1 UTSW 1 97098498 missense probably damaging 1.00
R1594:Slco6c1 UTSW 1 97062438 missense probably benign 0.36
R1901:Slco6c1 UTSW 1 97072982 missense probably damaging 0.98
R2005:Slco6c1 UTSW 1 97081489 missense probably damaging 0.99
R2101:Slco6c1 UTSW 1 97072870 nonsense probably null
R2102:Slco6c1 UTSW 1 97127931 missense probably benign 0.02
R2120:Slco6c1 UTSW 1 97066083 missense possibly damaging 0.57
R2135:Slco6c1 UTSW 1 97104817 missense probably benign 0.01
R2295:Slco6c1 UTSW 1 97125748 missense probably damaging 1.00
R2437:Slco6c1 UTSW 1 97062476 missense probably benign 0.22
R4004:Slco6c1 UTSW 1 97075885 missense probably damaging 1.00
R4133:Slco6c1 UTSW 1 97081493 missense probably benign 0.02
R4643:Slco6c1 UTSW 1 97062424 missense probably benign 0.00
R4786:Slco6c1 UTSW 1 97087995 missense probably benign 0.04
R4942:Slco6c1 UTSW 1 97081324 missense probably damaging 1.00
R5485:Slco6c1 UTSW 1 97125756 missense probably damaging 1.00
R5573:Slco6c1 UTSW 1 97127931 missense probably benign 0.00
R5810:Slco6c1 UTSW 1 97075873 missense probably damaging 1.00
R6033:Slco6c1 UTSW 1 97081316 splice site probably null
R6033:Slco6c1 UTSW 1 97081316 splice site probably null
R6191:Slco6c1 UTSW 1 97066083 missense possibly damaging 0.57
R6197:Slco6c1 UTSW 1 97072793 critical splice donor site probably null
R6286:Slco6c1 UTSW 1 97125720 missense possibly damaging 0.90
R6404:Slco6c1 UTSW 1 97118605 missense probably damaging 1.00
R6430:Slco6c1 UTSW 1 97075974 missense probably benign 0.43
R6492:Slco6c1 UTSW 1 97125813 missense probably damaging 0.99
R6649:Slco6c1 UTSW 1 97125711 missense probably benign 0.44
R6940:Slco6c1 UTSW 1 97072901 missense possibly damaging 0.80
R7138:Slco6c1 UTSW 1 97119981 missense possibly damaging 0.95
R7213:Slco6c1 UTSW 1 97127946 missense probably benign
R7234:Slco6c1 UTSW 1 97125741 missense probably benign 0.06
R7320:Slco6c1 UTSW 1 97128162 missense possibly damaging 0.83
R7375:Slco6c1 UTSW 1 97081421 missense possibly damaging 0.58
R7383:Slco6c1 UTSW 1 97075883 nonsense probably null
R7422:Slco6c1 UTSW 1 97081482 missense probably benign 0.17
R7491:Slco6c1 UTSW 1 97127854 missense probably benign 0.32
R7561:Slco6c1 UTSW 1 97072966 missense probably damaging 1.00
R7890:Slco6c1 UTSW 1 97062467 missense possibly damaging 0.59
R8115:Slco6c1 UTSW 1 97072961 missense probably damaging 1.00
R8409:Slco6c1 UTSW 1 97075938 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACAGTATCTCACCTATGCTTTGTC -3'
(R):5'- GAGGGTTCAAATGTAGTTGATCTC -3'

Sequencing Primer
(F):5'- ACCTATGCTTTGTCTTCCCGG -3'
(R):5'- CTCTATGACTACTAATACAGGTACT -3'
Posted On2020-10-20