Incidental Mutation 'R8422:Olfr1212'
ID653238
Institutional Source Beutler Lab
Gene Symbol Olfr1212
Ensembl Gene ENSMUSG00000048226
Gene Nameolfactory receptor 1212
SynonymsGA_x6K02T2Q125-50437014-50437949, MOR233-20, MOR233-17
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R8422 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location88953969-88961313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88958997 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 177 (M177T)
Ref Sequence ENSEMBL: ENSMUSP00000149781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055895] [ENSMUST00000215781]
Predicted Effect probably benign
Transcript: ENSMUST00000055895
AA Change: M177T

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000052837
Gene: ENSMUSG00000048226
AA Change: M177T

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.9e-46 PFAM
Pfam:7tm_1 39 286 7.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215781
AA Change: M177T

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,662,297 S570R possibly damaging Het
4921517D22Rik T C 13: 59,691,629 M1V probably null Het
4921524J17Rik T G 8: 85,412,289 K57T possibly damaging Het
4930596D02Rik G T 14: 35,810,052 Q189K probably benign Het
Anapc1 T C 2: 128,675,837 T296A probably benign Het
Aqp7 T A 4: 41,035,622 M78L probably benign Het
C1qtnf5 C A 9: 44,108,664 A195E possibly damaging Het
Calhm2 T C 19: 47,133,140 I197V probably benign Het
Ccdc186 G A 19: 56,813,185 L167F probably benign Het
Ccr3 T C 9: 124,028,762 Y45H probably damaging Het
Cct3 G C 3: 88,300,819 R38P probably damaging Het
Clstn2 T C 9: 97,458,186 D711G probably benign Het
Dab2ip T A 2: 35,707,755 I157N probably damaging Het
Dchs2 T C 3: 83,325,263 V2185A probably benign Het
Dis3l2 A G 1: 86,854,377 T219A probably benign Het
F2rl3 G T 8: 72,763,185 V347L probably benign Het
Fastkd1 A G 2: 69,702,434 S530P probably damaging Het
Fgfr3 T A 5: 33,734,905 Y689* probably null Het
Gm10521 A G 1: 171,896,459 I112M unknown Het
Gm9736 C A 10: 77,750,880 V159F unknown Het
Hba-x A T 11: 32,277,736 H88L probably benign Het
Il12rb2 A T 6: 67,360,816 V27E probably benign Het
Imp4 G T 1: 34,443,916 G196V probably damaging Het
Itga11 A C 9: 62,767,678 I831L probably benign Het
Macf1 C T 4: 123,409,486 V408I possibly damaging Het
Nedd4 T A 9: 72,742,682 D771E probably damaging Het
Noc3l T C 19: 38,807,103 Y413C probably benign Het
Npas3 C A 12: 54,068,509 T738K probably benign Het
Ntrk2 A T 13: 58,985,901 D498V probably damaging Het
Nyap1 T C 5: 137,735,821 T317A probably benign Het
Olfr294 T A 7: 86,616,258 H129L probably benign Het
Olfr74 T A 2: 87,973,799 I289L probably benign Het
Olfr978 T C 9: 39,994,554 L248P probably damaging Het
Pcdhb20 A T 18: 37,504,796 D125V probably damaging Het
Phc3 G A 3: 30,929,890 Q692* probably null Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Ppp1r12a T A 10: 108,241,181 H339Q probably benign Het
Ppp1r3a G A 6: 14,718,435 Q827* probably null Het
Ptpra T A 2: 130,532,171 I265N possibly damaging Het
Rabggta G T 14: 55,718,458 H447Q probably benign Het
Ralgps1 T C 2: 33,172,430 D277G possibly damaging Het
Riok3 A T 18: 12,136,812 E100V probably null Het
Rtcb C T 10: 85,943,304 V362M probably benign Het
Scd2 G T 19: 44,301,304 C246F probably benign Het
Slco6c1 T C 1: 97,125,783 E131G probably damaging Het
Tanc2 A G 11: 105,835,188 M393V probably benign Het
Tas2r136 A T 6: 132,777,327 I279N probably damaging Het
Tbx3 G T 5: 119,680,516 K405N possibly damaging Het
Thumpd2 A T 17: 81,026,944 V405D probably damaging Het
Tlr12 A G 4: 128,616,634 S608P probably damaging Het
Wfs1 T C 5: 36,973,875 K165E probably benign Het
Zfp810 C A 9: 22,283,222 E57* probably null Het
Other mutations in Olfr1212
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Olfr1212 APN 2 88958766 missense probably damaging 0.98
IGL01398:Olfr1212 APN 2 88958849 missense probably damaging 1.00
IGL01537:Olfr1212 APN 2 88958541 missense probably benign 0.00
IGL02197:Olfr1212 APN 2 88958684 missense probably benign 0.05
IGL02557:Olfr1212 APN 2 88958681 missense probably benign 0.00
R0276:Olfr1212 UTSW 2 88958755 nonsense probably null
R0568:Olfr1212 UTSW 2 88959043 nonsense probably null
R0699:Olfr1212 UTSW 2 88958616 missense probably benign 0.31
R1101:Olfr1212 UTSW 2 88958984 missense possibly damaging 0.60
R1205:Olfr1212 UTSW 2 88958588 missense probably benign 0.00
R1468:Olfr1212 UTSW 2 88959043 nonsense probably null
R1468:Olfr1212 UTSW 2 88959043 nonsense probably null
R1845:Olfr1212 UTSW 2 88958867 missense probably damaging 0.99
R2031:Olfr1212 UTSW 2 88959299 missense probably benign 0.19
R2418:Olfr1212 UTSW 2 88959036 missense probably benign 0.01
R2419:Olfr1212 UTSW 2 88959036 missense probably benign 0.01
R3781:Olfr1212 UTSW 2 88958747 nonsense probably null
R4049:Olfr1212 UTSW 2 88959273 missense probably benign 0.09
R4440:Olfr1212 UTSW 2 88959341 missense probably benign 0.22
R4583:Olfr1212 UTSW 2 88959212 missense probably damaging 0.99
R4646:Olfr1212 UTSW 2 88959212 missense probably damaging 0.99
R4648:Olfr1212 UTSW 2 88959212 missense probably damaging 0.99
R4674:Olfr1212 UTSW 2 88958872 missense probably damaging 0.98
R4851:Olfr1212 UTSW 2 88958586 missense probably damaging 1.00
R4971:Olfr1212 UTSW 2 88958519 missense probably damaging 1.00
R5610:Olfr1212 UTSW 2 88958826 missense probably damaging 1.00
R5805:Olfr1212 UTSW 2 88958641 missense possibly damaging 0.50
R5887:Olfr1212 UTSW 2 88958754 missense possibly damaging 0.60
R6023:Olfr1212 UTSW 2 88958715 missense possibly damaging 0.76
R6118:Olfr1212 UTSW 2 88959118 nonsense probably null
R7490:Olfr1212 UTSW 2 88959048 missense probably benign 0.00
R7542:Olfr1212 UTSW 2 88958775 missense probably benign 0.01
R7612:Olfr1212 UTSW 2 88958505 missense probably damaging 1.00
R7972:Olfr1212 UTSW 2 88958833 nonsense probably null
Z1177:Olfr1212 UTSW 2 88959377 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTATGACACAGATCTTTGCTGAAC -3'
(R):5'- TCGCCCTTCAGAACTGTGAC -3'

Sequencing Primer
(F):5'- CCATGGCTTATGACCGATATGTAGC -3'
(R):5'- CCTTCAGAACTGTGACTTCTTAGAG -3'
Posted On2020-10-20