Mutagenetix > Incidental Mutations

Incidental Mutation 'R8422:Olfr1212'

653238

Institutional Source

Beutler Lab

Gene Symbol

Olfr1212

Ensembl Gene

ENSMUSG00000048226

Gene Name

olfactory receptor 1212

Synonyms

GA_x6K02T2Q125-50437014-50437949, MOR233-20, MOR233-17

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.067) question?

Stock #

R8422 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

88953969-88961313 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 88958997 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 177 (M177T)

Ref Sequence

ENSEMBL: ENSMUSP00000149781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055895] [ENSMUST00000215781]

Predicted Effect

probably benign
Transcript: ENSMUST00000055895
AA Change: M177T

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000052837
Gene: ENSMUSG00000048226
AA Change: M177T

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	303	1.9e-46	PFAM
Pfam:7tm_1	39	286	7.1e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000215781
AA Change: M177T

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	G	T	14: 32,662,297	S570R	possibly damaging	Het
4921517D22Rik	T	C	13: 59,691,629	M1V	probably null	Het
4921524J17Rik	T	G	8: 85,412,289	K57T	possibly damaging	Het
4930596D02Rik	G	T	14: 35,810,052	Q189K	probably benign	Het
Anapc1	T	C	2: 128,675,837	T296A	probably benign	Het
Aqp7	T	A	4: 41,035,622	M78L	probably benign	Het
C1qtnf5	C	A	9: 44,108,664	A195E	possibly damaging	Het
Calhm2	T	C	19: 47,133,140	I197V	probably benign	Het
Ccdc186	G	A	19: 56,813,185	L167F	probably benign	Het
Ccr3	T	C	9: 124,028,762	Y45H	probably damaging	Het
Cct3	G	C	3: 88,300,819	R38P	probably damaging	Het
Clstn2	T	C	9: 97,458,186	D711G	probably benign	Het
Dab2ip	T	A	2: 35,707,755	I157N	probably damaging	Het
Dchs2	T	C	3: 83,325,263	V2185A	probably benign	Het
Dis3l2	A	G	1: 86,854,377	T219A	probably benign	Het
F2rl3	G	T	8: 72,763,185	V347L	probably benign	Het
Fastkd1	A	G	2: 69,702,434	S530P	probably damaging	Het
Fgfr3	T	A	5: 33,734,905	Y689*	probably null	Het
Gm10521	A	G	1: 171,896,459	I112M	unknown	Het
Gm9736	C	A	10: 77,750,880	V159F	unknown	Het
Hba-x	A	T	11: 32,277,736	H88L	probably benign	Het
Il12rb2	A	T	6: 67,360,816	V27E	probably benign	Het
Imp4	G	T	1: 34,443,916	G196V	probably damaging	Het
Itga11	A	C	9: 62,767,678	I831L	probably benign	Het
Macf1	C	T	4: 123,409,486	V408I	possibly damaging	Het
Nedd4	T	A	9: 72,742,682	D771E	probably damaging	Het
Noc3l	T	C	19: 38,807,103	Y413C	probably benign	Het
Npas3	C	A	12: 54,068,509	T738K	probably benign	Het
Ntrk2	A	T	13: 58,985,901	D498V	probably damaging	Het
Nyap1	T	C	5: 137,735,821	T317A	probably benign	Het
Olfr294	T	A	7: 86,616,258	H129L	probably benign	Het
Olfr74	T	A	2: 87,973,799	I289L	probably benign	Het
Olfr978	T	C	9: 39,994,554	L248P	probably damaging	Het
Pcdhb20	A	T	18: 37,504,796	D125V	probably damaging	Het
Phc3	G	A	3: 30,929,890	Q692*	probably null	Het
Plat	G	T	8: 22,772,232	G91W	probably damaging	Het
Ppp1r12a	T	A	10: 108,241,181	H339Q	probably benign	Het
Ppp1r3a	G	A	6: 14,718,435	Q827*	probably null	Het
Ptpra	T	A	2: 130,532,171	I265N	possibly damaging	Het
Rabggta	G	T	14: 55,718,458	H447Q	probably benign	Het
Ralgps1	T	C	2: 33,172,430	D277G	possibly damaging	Het
Riok3	A	T	18: 12,136,812	E100V	probably null	Het
Rtcb	C	T	10: 85,943,304	V362M	probably benign	Het
Scd2	G	T	19: 44,301,304	C246F	probably benign	Het
Slco6c1	T	C	1: 97,125,783	E131G	probably damaging	Het
Tanc2	A	G	11: 105,835,188	M393V	probably benign	Het
Tas2r136	A	T	6: 132,777,327	I279N	probably damaging	Het
Tbx3	G	T	5: 119,680,516	K405N	possibly damaging	Het
Thumpd2	A	T	17: 81,026,944	V405D	probably damaging	Het
Tlr12	A	G	4: 128,616,634	S608P	probably damaging	Het
Wfs1	T	C	5: 36,973,875	K165E	probably benign	Het
Zfp810	C	A	9: 22,283,222	E57*	probably null	Het

Other mutations in Olfr1212

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Olfr1212	APN	2	88958766	missense	probably damaging	0.98
IGL01398:Olfr1212	APN	2	88958849	missense	probably damaging	1.00
IGL01537:Olfr1212	APN	2	88958541	missense	probably benign	0.00
IGL02197:Olfr1212	APN	2	88958684	missense	probably benign	0.05
IGL02557:Olfr1212	APN	2	88958681	missense	probably benign	0.00
R0276:Olfr1212	UTSW	2	88958755	nonsense	probably null
R0568:Olfr1212	UTSW	2	88959043	nonsense	probably null
R0699:Olfr1212	UTSW	2	88958616	missense	probably benign	0.31
R1101:Olfr1212	UTSW	2	88958984	missense	possibly damaging	0.60
R1205:Olfr1212	UTSW	2	88958588	missense	probably benign	0.00
R1468:Olfr1212	UTSW	2	88959043	nonsense	probably null
R1468:Olfr1212	UTSW	2	88959043	nonsense	probably null
R1845:Olfr1212	UTSW	2	88958867	missense	probably damaging	0.99
R2031:Olfr1212	UTSW	2	88959299	missense	probably benign	0.19
R2418:Olfr1212	UTSW	2	88959036	missense	probably benign	0.01
R2419:Olfr1212	UTSW	2	88959036	missense	probably benign	0.01
R3781:Olfr1212	UTSW	2	88958747	nonsense	probably null
R4049:Olfr1212	UTSW	2	88959273	missense	probably benign	0.09
R4440:Olfr1212	UTSW	2	88959341	missense	probably benign	0.22
R4583:Olfr1212	UTSW	2	88959212	missense	probably damaging	0.99
R4646:Olfr1212	UTSW	2	88959212	missense	probably damaging	0.99
R4648:Olfr1212	UTSW	2	88959212	missense	probably damaging	0.99
R4674:Olfr1212	UTSW	2	88958872	missense	probably damaging	0.98
R4851:Olfr1212	UTSW	2	88958586	missense	probably damaging	1.00
R4971:Olfr1212	UTSW	2	88958519	missense	probably damaging	1.00
R5610:Olfr1212	UTSW	2	88958826	missense	probably damaging	1.00
R5805:Olfr1212	UTSW	2	88958641	missense	possibly damaging	0.50
R5887:Olfr1212	UTSW	2	88958754	missense	possibly damaging	0.60
R6023:Olfr1212	UTSW	2	88958715	missense	possibly damaging	0.76
R6118:Olfr1212	UTSW	2	88959118	nonsense	probably null
R7490:Olfr1212	UTSW	2	88959048	missense	probably benign	0.00
R7542:Olfr1212	UTSW	2	88958775	missense	probably benign	0.01
R7612:Olfr1212	UTSW	2	88958505	missense	probably damaging	1.00
R7972:Olfr1212	UTSW	2	88958833	nonsense	probably null
Z1177:Olfr1212	UTSW	2	88959377	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTATGACACAGATCTTTGCTGAAC -3'
(R):5'- TCGCCCTTCAGAACTGTGAC -3'

Sequencing Primer
(F):5'- CCATGGCTTATGACCGATATGTAGC -3'
(R):5'- CCTTCAGAACTGTGACTTCTTAGAG -3'

Posted On

2020-10-20