Incidental Mutation 'R8422:Anapc1'
ID 653239
Institutional Source Beutler Lab
Gene Symbol Anapc1
Ensembl Gene ENSMUSG00000014355
Gene Name anaphase promoting complex subunit 1
Synonyms Apc1, tsg24, Mcpr, 2610021O03Rik
MMRRC Submission 067817-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8422 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 128452024-128529311 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128517757 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 296 (T296A)
Ref Sequence ENSEMBL: ENSMUSP00000014499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014499] [ENSMUST00000110333]
AlphaFold P53995
Predicted Effect probably benign
Transcript: ENSMUST00000014499
AA Change: T296A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: T296A

DomainStartEndE-ValueType
Pfam:ANAPC1 150 214 1.7e-13 PFAM
low complexity region 323 345 N/A INTRINSIC
low complexity region 1404 1415 N/A INTRINSIC
Pfam:PC_rep 1467 1501 8.3e-8 PFAM
low complexity region 1516 1528 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110333
AA Change: T296A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105962
Gene: ENSMUSG00000014355
AA Change: T296A

DomainStartEndE-ValueType
Pfam:Apc1 149 227 1.7e-22 PFAM
low complexity region 323 345 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,384,254 (GRCm39) S570R possibly damaging Het
4921517D22Rik T C 13: 59,839,443 (GRCm39) M1V probably null Het
4921524J17Rik T G 8: 86,138,918 (GRCm39) K57T possibly damaging Het
4930596D02Rik G T 14: 35,532,009 (GRCm39) Q189K probably benign Het
Aqp7 T A 4: 41,035,622 (GRCm39) M78L probably benign Het
C1qtnf5 C A 9: 44,019,961 (GRCm39) A195E possibly damaging Het
Calhm2 T C 19: 47,121,579 (GRCm39) I197V probably benign Het
Ccdc186 G A 19: 56,801,617 (GRCm39) L167F probably benign Het
Ccr3 T C 9: 123,828,799 (GRCm39) Y45H probably damaging Het
Cct3 G C 3: 88,208,126 (GRCm39) R38P probably damaging Het
Clstn2 T C 9: 97,340,239 (GRCm39) D711G probably benign Het
Dab2ip T A 2: 35,597,767 (GRCm39) I157N probably damaging Het
Dchs2 T C 3: 83,232,570 (GRCm39) V2185A probably benign Het
Dis3l2 A G 1: 86,782,099 (GRCm39) T219A probably benign Het
F2rl3 G T 8: 73,489,813 (GRCm39) V347L probably benign Het
Fastkd1 A G 2: 69,532,778 (GRCm39) S530P probably damaging Het
Fgfr3 T A 5: 33,892,249 (GRCm39) Y689* probably null Het
Gm10521 A G 1: 171,724,026 (GRCm39) I112M unknown Het
Gm9736 C A 10: 77,586,714 (GRCm39) V159F unknown Het
Hba-x A T 11: 32,227,736 (GRCm39) H88L probably benign Het
Il12rb2 A T 6: 67,337,800 (GRCm39) V27E probably benign Het
Imp4 G T 1: 34,482,997 (GRCm39) G196V probably damaging Het
Itga11 A C 9: 62,674,960 (GRCm39) I831L probably benign Het
Macf1 C T 4: 123,303,279 (GRCm39) V408I possibly damaging Het
Nedd4 T A 9: 72,649,964 (GRCm39) D771E probably damaging Het
Noc3l T C 19: 38,795,547 (GRCm39) Y413C probably benign Het
Npas3 C A 12: 54,115,292 (GRCm39) T738K probably benign Het
Ntrk2 A T 13: 59,133,715 (GRCm39) D498V probably damaging Het
Nyap1 T C 5: 137,734,083 (GRCm39) T317A probably benign Het
Or10g7 T C 9: 39,905,850 (GRCm39) L248P probably damaging Het
Or14a256 T A 7: 86,265,466 (GRCm39) H129L probably benign Het
Or4c107 T C 2: 88,789,341 (GRCm39) M177T probably benign Het
Or5d47 T A 2: 87,804,143 (GRCm39) I289L probably benign Het
Pcdhb20 A T 18: 37,637,849 (GRCm39) D125V probably damaging Het
Phc3 G A 3: 30,984,039 (GRCm39) Q692* probably null Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Ppp1r12a T A 10: 108,077,042 (GRCm39) H339Q probably benign Het
Ppp1r3a G A 6: 14,718,434 (GRCm39) Q827* probably null Het
Ptpra T A 2: 130,374,091 (GRCm39) I265N possibly damaging Het
Rabggta G T 14: 55,955,915 (GRCm39) H447Q probably benign Het
Ralgps1 T C 2: 33,062,442 (GRCm39) D277G possibly damaging Het
Riok3 A T 18: 12,269,869 (GRCm39) E100V probably null Het
Rtcb C T 10: 85,779,168 (GRCm39) V362M probably benign Het
Scd2 G T 19: 44,289,743 (GRCm39) C246F probably benign Het
Slco6c1 T C 1: 97,053,508 (GRCm39) E131G probably damaging Het
Tanc2 A G 11: 105,726,014 (GRCm39) M393V probably benign Het
Tas2r136 A T 6: 132,754,290 (GRCm39) I279N probably damaging Het
Tbx3 G T 5: 119,818,581 (GRCm39) K405N possibly damaging Het
Thumpd2 A T 17: 81,334,373 (GRCm39) V405D probably damaging Het
Tlr12 A G 4: 128,510,427 (GRCm39) S608P probably damaging Het
Wfs1 T C 5: 37,131,219 (GRCm39) K165E probably benign Het
Zfp810 C A 9: 22,194,518 (GRCm39) E57* probably null Het
Other mutations in Anapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Anapc1 APN 2 128,487,050 (GRCm39) splice site probably benign
IGL00704:Anapc1 APN 2 128,505,904 (GRCm39) missense possibly damaging 0.48
IGL01023:Anapc1 APN 2 128,471,649 (GRCm39) missense probably damaging 1.00
IGL01432:Anapc1 APN 2 128,475,328 (GRCm39) missense probably damaging 1.00
IGL01549:Anapc1 APN 2 128,495,090 (GRCm39) missense probably benign
IGL02089:Anapc1 APN 2 128,505,853 (GRCm39) missense probably damaging 1.00
IGL02275:Anapc1 APN 2 128,501,772 (GRCm39) missense probably benign
IGL02570:Anapc1 APN 2 128,487,120 (GRCm39) missense probably damaging 1.00
IGL02597:Anapc1 APN 2 128,465,851 (GRCm39) missense probably benign 0.02
IGL02726:Anapc1 APN 2 128,501,705 (GRCm39) missense probably benign 0.05
IGL03265:Anapc1 APN 2 128,469,117 (GRCm39) missense probably damaging 1.00
IGL03304:Anapc1 APN 2 128,469,033 (GRCm39) splice site probably benign
IGL03327:Anapc1 APN 2 128,465,854 (GRCm39) missense probably benign 0.00
R0023:Anapc1 UTSW 2 128,520,138 (GRCm39) missense probably damaging 0.99
R0027:Anapc1 UTSW 2 128,483,431 (GRCm39) missense possibly damaging 0.96
R0027:Anapc1 UTSW 2 128,483,431 (GRCm39) missense possibly damaging 0.96
R0084:Anapc1 UTSW 2 128,465,886 (GRCm39) splice site probably benign
R0103:Anapc1 UTSW 2 128,522,372 (GRCm39) splice site probably benign
R0103:Anapc1 UTSW 2 128,522,372 (GRCm39) splice site probably benign
R0109:Anapc1 UTSW 2 128,476,613 (GRCm39) missense probably damaging 1.00
R0109:Anapc1 UTSW 2 128,476,613 (GRCm39) missense probably damaging 1.00
R0241:Anapc1 UTSW 2 128,470,549 (GRCm39) missense possibly damaging 0.89
R0241:Anapc1 UTSW 2 128,470,549 (GRCm39) missense possibly damaging 0.89
R0255:Anapc1 UTSW 2 128,476,631 (GRCm39) missense probably damaging 0.99
R0377:Anapc1 UTSW 2 128,483,260 (GRCm39) critical splice donor site probably null
R0467:Anapc1 UTSW 2 128,510,963 (GRCm39) missense probably damaging 0.99
R0514:Anapc1 UTSW 2 128,474,575 (GRCm39) missense probably damaging 0.99
R0591:Anapc1 UTSW 2 128,461,252 (GRCm39) missense probably benign 0.17
R0919:Anapc1 UTSW 2 128,459,651 (GRCm39) missense probably benign
R1175:Anapc1 UTSW 2 128,522,108 (GRCm39) missense probably damaging 1.00
R1473:Anapc1 UTSW 2 128,459,617 (GRCm39) missense possibly damaging 0.88
R1547:Anapc1 UTSW 2 128,459,476 (GRCm39) missense probably benign 0.44
R1556:Anapc1 UTSW 2 128,466,819 (GRCm39) missense probably benign 0.00
R1567:Anapc1 UTSW 2 128,459,636 (GRCm39) missense probably damaging 1.00
R1635:Anapc1 UTSW 2 128,470,452 (GRCm39) missense probably damaging 1.00
R1645:Anapc1 UTSW 2 128,500,166 (GRCm39) critical splice donor site probably null
R1677:Anapc1 UTSW 2 128,518,128 (GRCm39) missense probably benign 0.09
R1854:Anapc1 UTSW 2 128,517,810 (GRCm39) missense probably damaging 1.00
R1856:Anapc1 UTSW 2 128,501,708 (GRCm39) missense probably damaging 0.96
R1959:Anapc1 UTSW 2 128,475,335 (GRCm39) missense probably benign 0.36
R1984:Anapc1 UTSW 2 128,511,608 (GRCm39) missense possibly damaging 0.85
R2034:Anapc1 UTSW 2 128,490,378 (GRCm39) missense possibly damaging 0.92
R2283:Anapc1 UTSW 2 128,484,468 (GRCm39) missense probably benign 0.23
R2928:Anapc1 UTSW 2 128,522,057 (GRCm39) missense probably damaging 1.00
R3547:Anapc1 UTSW 2 128,484,602 (GRCm39) missense possibly damaging 0.58
R3904:Anapc1 UTSW 2 128,484,439 (GRCm39) missense probably damaging 1.00
R4156:Anapc1 UTSW 2 128,469,149 (GRCm39) intron probably benign
R4359:Anapc1 UTSW 2 128,465,476 (GRCm39) missense possibly damaging 0.64
R4392:Anapc1 UTSW 2 128,518,169 (GRCm39) critical splice acceptor site probably null
R4574:Anapc1 UTSW 2 128,469,115 (GRCm39) missense probably damaging 1.00
R4682:Anapc1 UTSW 2 128,505,925 (GRCm39) missense probably benign 0.05
R4770:Anapc1 UTSW 2 128,527,980 (GRCm39) splice site probably benign
R4824:Anapc1 UTSW 2 128,470,610 (GRCm39) missense possibly damaging 0.69
R4960:Anapc1 UTSW 2 128,526,514 (GRCm39) missense probably benign 0.23
R5016:Anapc1 UTSW 2 128,449,095 (GRCm39) unclassified probably benign
R5063:Anapc1 UTSW 2 128,471,469 (GRCm39) missense possibly damaging 0.48
R5128:Anapc1 UTSW 2 128,501,837 (GRCm39) missense probably benign
R5271:Anapc1 UTSW 2 128,527,905 (GRCm39) nonsense probably null
R5363:Anapc1 UTSW 2 128,492,114 (GRCm39) critical splice donor site probably null
R5469:Anapc1 UTSW 2 128,517,621 (GRCm39) nonsense probably null
R5473:Anapc1 UTSW 2 128,449,115 (GRCm39) unclassified probably benign
R5559:Anapc1 UTSW 2 128,522,354 (GRCm39) nonsense probably null
R5631:Anapc1 UTSW 2 128,499,137 (GRCm39) missense possibly damaging 0.85
R5747:Anapc1 UTSW 2 128,466,836 (GRCm39) missense probably benign 0.19
R5840:Anapc1 UTSW 2 128,448,957 (GRCm39) unclassified probably benign
R6226:Anapc1 UTSW 2 128,492,292 (GRCm39) missense probably damaging 1.00
R6526:Anapc1 UTSW 2 128,514,055 (GRCm39) nonsense probably null
R6561:Anapc1 UTSW 2 128,505,919 (GRCm39) missense probably damaging 0.98
R6743:Anapc1 UTSW 2 128,526,454 (GRCm39) nonsense probably null
R6799:Anapc1 UTSW 2 128,501,657 (GRCm39) missense probably null 0.38
R6887:Anapc1 UTSW 2 128,501,688 (GRCm39) missense possibly damaging 0.91
R6978:Anapc1 UTSW 2 128,511,820 (GRCm39) missense probably benign 0.06
R7011:Anapc1 UTSW 2 128,490,601 (GRCm39) splice site probably null
R7041:Anapc1 UTSW 2 128,470,576 (GRCm39) missense possibly damaging 0.88
R7047:Anapc1 UTSW 2 128,457,350 (GRCm39) missense probably damaging 0.96
R7074:Anapc1 UTSW 2 128,520,194 (GRCm39) missense probably damaging 1.00
R7109:Anapc1 UTSW 2 128,516,522 (GRCm39) missense probably benign 0.33
R7123:Anapc1 UTSW 2 128,454,930 (GRCm39) missense probably damaging 1.00
R7309:Anapc1 UTSW 2 128,516,604 (GRCm39) missense probably damaging 0.96
R7693:Anapc1 UTSW 2 128,483,457 (GRCm39) missense possibly damaging 0.86
R7839:Anapc1 UTSW 2 128,526,528 (GRCm39) missense probably damaging 0.99
R7847:Anapc1 UTSW 2 128,511,828 (GRCm39) missense possibly damaging 0.93
R7960:Anapc1 UTSW 2 128,516,513 (GRCm39) missense probably damaging 1.00
R8061:Anapc1 UTSW 2 128,490,408 (GRCm39) missense probably damaging 0.98
R8127:Anapc1 UTSW 2 128,474,547 (GRCm39) missense probably damaging 0.96
R8228:Anapc1 UTSW 2 128,461,837 (GRCm39) nonsense probably null
R8402:Anapc1 UTSW 2 128,472,148 (GRCm39) missense probably benign 0.02
R8425:Anapc1 UTSW 2 128,511,788 (GRCm39) missense probably damaging 1.00
R8469:Anapc1 UTSW 2 128,500,264 (GRCm39) splice site probably null
R8553:Anapc1 UTSW 2 128,461,833 (GRCm39) missense possibly damaging 0.80
R8688:Anapc1 UTSW 2 128,527,748 (GRCm39) missense probably benign 0.19
R8699:Anapc1 UTSW 2 128,483,373 (GRCm39) missense probably damaging 1.00
R8719:Anapc1 UTSW 2 128,483,369 (GRCm39) missense probably damaging 1.00
R8775:Anapc1 UTSW 2 128,499,093 (GRCm39) missense possibly damaging 0.92
R8775-TAIL:Anapc1 UTSW 2 128,499,093 (GRCm39) missense possibly damaging 0.92
R8806:Anapc1 UTSW 2 128,464,333 (GRCm39) missense possibly damaging 0.67
R8973:Anapc1 UTSW 2 128,505,952 (GRCm39) missense probably damaging 0.99
R8977:Anapc1 UTSW 2 128,483,322 (GRCm39) missense probably damaging 1.00
R9000:Anapc1 UTSW 2 128,476,628 (GRCm39) missense probably damaging 1.00
R9080:Anapc1 UTSW 2 128,464,426 (GRCm39) missense possibly damaging 0.82
R9203:Anapc1 UTSW 2 128,465,422 (GRCm39) missense possibly damaging 0.66
R9314:Anapc1 UTSW 2 128,464,420 (GRCm39) missense possibly damaging 0.69
R9386:Anapc1 UTSW 2 128,459,642 (GRCm39) missense probably benign 0.08
R9415:Anapc1 UTSW 2 128,476,598 (GRCm39) missense probably benign
R9436:Anapc1 UTSW 2 128,518,045 (GRCm39) missense probably benign
R9516:Anapc1 UTSW 2 128,517,633 (GRCm39) missense possibly damaging 0.77
R9563:Anapc1 UTSW 2 128,505,980 (GRCm39) nonsense probably null
R9572:Anapc1 UTSW 2 128,505,976 (GRCm39) missense probably benign
R9757:Anapc1 UTSW 2 128,517,676 (GRCm39) missense probably damaging 1.00
R9766:Anapc1 UTSW 2 128,500,221 (GRCm39) missense probably damaging 1.00
X0066:Anapc1 UTSW 2 128,516,621 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGACATCCACCTTAGAGCCG -3'
(R):5'- GAACCCTGAACACTTGCACTG -3'

Sequencing Primer
(F):5'- CTTAGAGCCGCCATGTTGGAAATG -3'
(R):5'- CACTGAGCACTTTGAGATCAGTTGAG -3'
Posted On 2020-10-20