Incidental Mutation 'R8422:Ppp1r3a'
ID 653251
Institutional Source Beutler Lab
Gene Symbol Ppp1r3a
Ensembl Gene ENSMUSG00000042717
Gene Name protein phosphatase 1, regulatory subunit 3A
Synonyms RGL, GM
MMRRC Submission 067817-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8422 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 14713976-14755273 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 14718434 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 827 (Q827*)
Ref Sequence ENSEMBL: ENSMUSP00000049054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045096]
AlphaFold Q99MR9
Predicted Effect probably null
Transcript: ENSMUST00000045096
AA Change: Q827*
SMART Domains Protein: ENSMUSP00000049054
Gene: ENSMUSG00000042717
AA Change: Q827*

DomainStartEndE-ValueType
low complexity region 37 51 N/A INTRINSIC
Pfam:CBM_21 124 231 2.3e-32 PFAM
low complexity region 370 381 N/A INTRINSIC
low complexity region 636 646 N/A INTRINSIC
low complexity region 952 961 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycogen-associated form of protein phosphatase-1 (PP1) derived from skeletal muscle is a heterodimer composed of a 37-kD catalytic subunit and a 124-kD targeting and regulatory subunit. This gene encodes the regulatory subunit which binds to muscle glycogen with high affinity, thereby enhancing dephosphorylation of glycogen-bound substrates for PP1 such as glycogen synthase and glycogen phosphorylase kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have reduced levels of skeletal muscle glycogen. Whereas one model was normoglycemic and grossly normal, another on a similar genetic background was glucose intolerant, insulin resistant, and gained weight to the point of obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,384,254 (GRCm39) S570R possibly damaging Het
4921517D22Rik T C 13: 59,839,443 (GRCm39) M1V probably null Het
4921524J17Rik T G 8: 86,138,918 (GRCm39) K57T possibly damaging Het
4930596D02Rik G T 14: 35,532,009 (GRCm39) Q189K probably benign Het
Anapc1 T C 2: 128,517,757 (GRCm39) T296A probably benign Het
Aqp7 T A 4: 41,035,622 (GRCm39) M78L probably benign Het
C1qtnf5 C A 9: 44,019,961 (GRCm39) A195E possibly damaging Het
Calhm2 T C 19: 47,121,579 (GRCm39) I197V probably benign Het
Ccdc186 G A 19: 56,801,617 (GRCm39) L167F probably benign Het
Ccr3 T C 9: 123,828,799 (GRCm39) Y45H probably damaging Het
Cct3 G C 3: 88,208,126 (GRCm39) R38P probably damaging Het
Clstn2 T C 9: 97,340,239 (GRCm39) D711G probably benign Het
Dab2ip T A 2: 35,597,767 (GRCm39) I157N probably damaging Het
Dchs2 T C 3: 83,232,570 (GRCm39) V2185A probably benign Het
Dis3l2 A G 1: 86,782,099 (GRCm39) T219A probably benign Het
F2rl3 G T 8: 73,489,813 (GRCm39) V347L probably benign Het
Fastkd1 A G 2: 69,532,778 (GRCm39) S530P probably damaging Het
Fgfr3 T A 5: 33,892,249 (GRCm39) Y689* probably null Het
Gm10521 A G 1: 171,724,026 (GRCm39) I112M unknown Het
Gm9736 C A 10: 77,586,714 (GRCm39) V159F unknown Het
Hba-x A T 11: 32,227,736 (GRCm39) H88L probably benign Het
Il12rb2 A T 6: 67,337,800 (GRCm39) V27E probably benign Het
Imp4 G T 1: 34,482,997 (GRCm39) G196V probably damaging Het
Itga11 A C 9: 62,674,960 (GRCm39) I831L probably benign Het
Macf1 C T 4: 123,303,279 (GRCm39) V408I possibly damaging Het
Nedd4 T A 9: 72,649,964 (GRCm39) D771E probably damaging Het
Noc3l T C 19: 38,795,547 (GRCm39) Y413C probably benign Het
Npas3 C A 12: 54,115,292 (GRCm39) T738K probably benign Het
Ntrk2 A T 13: 59,133,715 (GRCm39) D498V probably damaging Het
Nyap1 T C 5: 137,734,083 (GRCm39) T317A probably benign Het
Or10g7 T C 9: 39,905,850 (GRCm39) L248P probably damaging Het
Or14a256 T A 7: 86,265,466 (GRCm39) H129L probably benign Het
Or4c107 T C 2: 88,789,341 (GRCm39) M177T probably benign Het
Or5d47 T A 2: 87,804,143 (GRCm39) I289L probably benign Het
Pcdhb20 A T 18: 37,637,849 (GRCm39) D125V probably damaging Het
Phc3 G A 3: 30,984,039 (GRCm39) Q692* probably null Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Ppp1r12a T A 10: 108,077,042 (GRCm39) H339Q probably benign Het
Ptpra T A 2: 130,374,091 (GRCm39) I265N possibly damaging Het
Rabggta G T 14: 55,955,915 (GRCm39) H447Q probably benign Het
Ralgps1 T C 2: 33,062,442 (GRCm39) D277G possibly damaging Het
Riok3 A T 18: 12,269,869 (GRCm39) E100V probably null Het
Rtcb C T 10: 85,779,168 (GRCm39) V362M probably benign Het
Scd2 G T 19: 44,289,743 (GRCm39) C246F probably benign Het
Slco6c1 T C 1: 97,053,508 (GRCm39) E131G probably damaging Het
Tanc2 A G 11: 105,726,014 (GRCm39) M393V probably benign Het
Tas2r136 A T 6: 132,754,290 (GRCm39) I279N probably damaging Het
Tbx3 G T 5: 119,818,581 (GRCm39) K405N possibly damaging Het
Thumpd2 A T 17: 81,334,373 (GRCm39) V405D probably damaging Het
Tlr12 A G 4: 128,510,427 (GRCm39) S608P probably damaging Het
Wfs1 T C 5: 37,131,219 (GRCm39) K165E probably benign Het
Zfp810 C A 9: 22,194,518 (GRCm39) E57* probably null Het
Other mutations in Ppp1r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ppp1r3a APN 6 14,755,083 (GRCm39) missense probably damaging 1.00
IGL00670:Ppp1r3a APN 6 14,719,059 (GRCm39) missense probably benign 0.22
IGL00703:Ppp1r3a APN 6 14,718,407 (GRCm39) missense probably benign 0.02
IGL00726:Ppp1r3a APN 6 14,717,851 (GRCm39) missense probably benign 0.42
IGL00742:Ppp1r3a APN 6 14,718,608 (GRCm39) missense probably benign 0.36
IGL01477:Ppp1r3a APN 6 14,718,345 (GRCm39) missense probably damaging 0.99
IGL01632:Ppp1r3a APN 6 14,754,810 (GRCm39) missense probably damaging 1.00
IGL02162:Ppp1r3a APN 6 14,717,714 (GRCm39) missense probably damaging 1.00
IGL02374:Ppp1r3a APN 6 14,718,599 (GRCm39) missense probably damaging 1.00
IGL02539:Ppp1r3a APN 6 14,718,458 (GRCm39) missense probably benign 0.01
IGL02563:Ppp1r3a APN 6 14,719,761 (GRCm39) missense probably benign 0.20
IGL02929:Ppp1r3a APN 6 14,719,810 (GRCm39) missense probably benign 0.00
IGL03110:Ppp1r3a APN 6 14,722,064 (GRCm39) splice site probably benign
IGL03290:Ppp1r3a APN 6 14,754,771 (GRCm39) missense probably damaging 1.00
IGL03326:Ppp1r3a APN 6 14,719,765 (GRCm39) missense probably damaging 0.96
P0041:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.00
PIT4445001:Ppp1r3a UTSW 6 14,717,776 (GRCm39) missense probably damaging 1.00
R0015:Ppp1r3a UTSW 6 14,717,660 (GRCm39) missense possibly damaging 0.58
R0077:Ppp1r3a UTSW 6 14,754,516 (GRCm39) missense possibly damaging 0.64
R0368:Ppp1r3a UTSW 6 14,718,959 (GRCm39) missense probably benign 0.26
R0391:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.43
R1793:Ppp1r3a UTSW 6 14,754,717 (GRCm39) missense probably damaging 1.00
R1797:Ppp1r3a UTSW 6 14,717,981 (GRCm39) missense probably benign 0.02
R1855:Ppp1r3a UTSW 6 14,754,993 (GRCm39) missense probably damaging 1.00
R1864:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R1865:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R2046:Ppp1r3a UTSW 6 14,722,103 (GRCm39) missense probably benign 0.12
R2122:Ppp1r3a UTSW 6 14,721,874 (GRCm39) missense possibly damaging 0.95
R2437:Ppp1r3a UTSW 6 14,718,322 (GRCm39) missense probably benign 0.03
R2518:Ppp1r3a UTSW 6 14,719,377 (GRCm39) missense possibly damaging 0.95
R2887:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2888:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2889:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R3419:Ppp1r3a UTSW 6 14,719,413 (GRCm39) missense probably benign 0.01
R3886:Ppp1r3a UTSW 6 14,719,911 (GRCm39) missense possibly damaging 0.87
R3937:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R3938:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R4246:Ppp1r3a UTSW 6 14,719,780 (GRCm39) missense probably damaging 1.00
R4561:Ppp1r3a UTSW 6 14,754,681 (GRCm39) missense probably damaging 1.00
R4701:Ppp1r3a UTSW 6 14,718,992 (GRCm39) missense probably benign 0.00
R4853:Ppp1r3a UTSW 6 14,719,046 (GRCm39) missense probably benign 0.03
R5076:Ppp1r3a UTSW 6 14,754,680 (GRCm39) missense probably damaging 1.00
R5085:Ppp1r3a UTSW 6 14,719,603 (GRCm39) missense probably damaging 1.00
R5501:Ppp1r3a UTSW 6 14,719,417 (GRCm39) missense probably benign 0.02
R5725:Ppp1r3a UTSW 6 14,719,348 (GRCm39) missense probably benign 0.04
R5729:Ppp1r3a UTSW 6 14,719,762 (GRCm39) missense probably benign 0.06
R5741:Ppp1r3a UTSW 6 14,719,882 (GRCm39) missense probably damaging 0.97
R5841:Ppp1r3a UTSW 6 14,718,983 (GRCm39) missense probably benign 0.26
R5914:Ppp1r3a UTSW 6 14,718,988 (GRCm39) missense probably benign 0.09
R6091:Ppp1r3a UTSW 6 14,719,339 (GRCm39) missense probably benign 0.02
R6154:Ppp1r3a UTSW 6 14,754,603 (GRCm39) missense possibly damaging 0.88
R6218:Ppp1r3a UTSW 6 14,718,430 (GRCm39) missense probably damaging 0.99
R6813:Ppp1r3a UTSW 6 14,719,570 (GRCm39) missense probably benign 0.13
R6826:Ppp1r3a UTSW 6 14,718,980 (GRCm39) nonsense probably null
R6869:Ppp1r3a UTSW 6 14,754,825 (GRCm39) missense probably benign 0.39
R7109:Ppp1r3a UTSW 6 14,719,235 (GRCm39) missense probably benign 0.00
R7188:Ppp1r3a UTSW 6 14,719,190 (GRCm39) missense probably benign 0.00
R7262:Ppp1r3a UTSW 6 14,719,069 (GRCm39) missense probably benign 0.04
R7341:Ppp1r3a UTSW 6 14,718,749 (GRCm39) missense probably damaging 0.97
R7770:Ppp1r3a UTSW 6 14,754,977 (GRCm39) missense probably benign 0.06
R7856:Ppp1r3a UTSW 6 14,718,025 (GRCm39) missense probably benign 0.01
R8309:Ppp1r3a UTSW 6 14,719,700 (GRCm39) missense probably benign 0.02
R8868:Ppp1r3a UTSW 6 14,755,014 (GRCm39) missense probably damaging 1.00
R9039:Ppp1r3a UTSW 6 14,754,525 (GRCm39) missense probably damaging 1.00
R9149:Ppp1r3a UTSW 6 14,722,098 (GRCm39) missense probably benign 0.32
R9302:Ppp1r3a UTSW 6 14,721,891 (GRCm39) missense probably benign 0.00
R9399:Ppp1r3a UTSW 6 14,755,010 (GRCm39) missense probably damaging 0.99
R9565:Ppp1r3a UTSW 6 14,719,466 (GRCm39) missense probably benign 0.02
R9730:Ppp1r3a UTSW 6 14,721,923 (GRCm39) missense probably benign 0.25
R9767:Ppp1r3a UTSW 6 14,718,101 (GRCm39) missense probably benign 0.03
R9782:Ppp1r3a UTSW 6 14,718,766 (GRCm39) missense probably damaging 1.00
Z1177:Ppp1r3a UTSW 6 14,755,150 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GCAGTGTCTGAGTTAAATGCAG -3'
(R):5'- GCGTTTGATCCACATGAAGGG -3'

Sequencing Primer
(F):5'- TGTCTGAGTTAAATGCAGAGGGAAC -3'
(R):5'- CCCTTTGTCATGGAGATACAGCAG -3'
Posted On 2020-10-20