Incidental Mutation 'R8422:Nedd4'
ID653262
Institutional Source Beutler Lab
Gene Symbol Nedd4
Ensembl Gene ENSMUSG00000032216
Gene Nameneural precursor cell expressed, developmentally down-regulated 4
SynonymsNedd4, Nedd4-1, Nedd4a
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8422 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location72662346-72749852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72742682 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 771 (D771E)
Ref Sequence ENSEMBL: ENSMUSP00000034740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034740]
PDB Structure Crystal structure of the Nedd4 C2/Grb10 SH2 complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000034740
AA Change: D771E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034740
Gene: ENSMUSG00000032216
AA Change: D771E

DomainStartEndE-ValueType
C2 79 181 5.38e-21 SMART
WW 250 282 2.32e-13 SMART
low complexity region 283 293 N/A INTRINSIC
WW 406 438 1.31e-12 SMART
WW 461 493 1.26e-14 SMART
HECTc 550 886 2.37e-194 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in neonatal lethality and heterozygous mice have decreased body weights. Mice homozygous for a knockout allele exhibit impaired neurite development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,662,297 S570R possibly damaging Het
4921517D22Rik T C 13: 59,691,629 M1V probably null Het
4921524J17Rik T G 8: 85,412,289 K57T possibly damaging Het
4930596D02Rik G T 14: 35,810,052 Q189K probably benign Het
Anapc1 T C 2: 128,675,837 T296A probably benign Het
Aqp7 T A 4: 41,035,622 M78L probably benign Het
C1qtnf5 C A 9: 44,108,664 A195E possibly damaging Het
Calhm2 T C 19: 47,133,140 I197V probably benign Het
Ccdc186 G A 19: 56,813,185 L167F probably benign Het
Ccr3 T C 9: 124,028,762 Y45H probably damaging Het
Cct3 G C 3: 88,300,819 R38P probably damaging Het
Clstn2 T C 9: 97,458,186 D711G probably benign Het
Dab2ip T A 2: 35,707,755 I157N probably damaging Het
Dchs2 T C 3: 83,325,263 V2185A probably benign Het
Dis3l2 A G 1: 86,854,377 T219A probably benign Het
F2rl3 G T 8: 72,763,185 V347L probably benign Het
Fastkd1 A G 2: 69,702,434 S530P probably damaging Het
Fgfr3 T A 5: 33,734,905 Y689* probably null Het
Gm10521 A G 1: 171,896,459 I112M unknown Het
Gm9736 C A 10: 77,750,880 V159F unknown Het
Hba-x A T 11: 32,277,736 H88L probably benign Het
Il12rb2 A T 6: 67,360,816 V27E probably benign Het
Imp4 G T 1: 34,443,916 G196V probably damaging Het
Itga11 A C 9: 62,767,678 I831L probably benign Het
Macf1 C T 4: 123,409,486 V408I possibly damaging Het
Noc3l T C 19: 38,807,103 Y413C probably benign Het
Npas3 C A 12: 54,068,509 T738K probably benign Het
Ntrk2 A T 13: 58,985,901 D498V probably damaging Het
Nyap1 T C 5: 137,735,821 T317A probably benign Het
Olfr1212 T C 2: 88,958,997 M177T probably benign Het
Olfr294 T A 7: 86,616,258 H129L probably benign Het
Olfr74 T A 2: 87,973,799 I289L probably benign Het
Olfr978 T C 9: 39,994,554 L248P probably damaging Het
Pcdhb20 A T 18: 37,504,796 D125V probably damaging Het
Phc3 G A 3: 30,929,890 Q692* probably null Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Ppp1r12a T A 10: 108,241,181 H339Q probably benign Het
Ppp1r3a G A 6: 14,718,435 Q827* probably null Het
Ptpra T A 2: 130,532,171 I265N possibly damaging Het
Rabggta G T 14: 55,718,458 H447Q probably benign Het
Ralgps1 T C 2: 33,172,430 D277G possibly damaging Het
Riok3 A T 18: 12,136,812 E100V probably null Het
Rtcb C T 10: 85,943,304 V362M probably benign Het
Scd2 G T 19: 44,301,304 C246F probably benign Het
Slco6c1 T C 1: 97,125,783 E131G probably damaging Het
Tanc2 A G 11: 105,835,188 M393V probably benign Het
Tas2r136 A T 6: 132,777,327 I279N probably damaging Het
Tbx3 G T 5: 119,680,516 K405N possibly damaging Het
Thumpd2 A T 17: 81,026,944 V405D probably damaging Het
Tlr12 A G 4: 128,616,634 S608P probably damaging Het
Wfs1 T C 5: 36,973,875 K165E probably benign Het
Zfp810 C A 9: 22,283,222 E57* probably null Het
Other mutations in Nedd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Nedd4 APN 9 72735089 missense probably damaging 1.00
IGL00573:Nedd4 APN 9 72686056 splice site probably null
IGL01973:Nedd4 APN 9 72736934 missense possibly damaging 0.81
IGL02177:Nedd4 APN 9 72747157 missense probably damaging 1.00
IGL03082:Nedd4 APN 9 72677394 critical splice donor site probably null
Evaporation UTSW 9 72686095 missense probably damaging 1.00
R7237_nedd4_908 UTSW 9 72725064 missense probably benign 0.04
Reduction UTSW 9 72731271 missense possibly damaging 0.49
Sublimation UTSW 9 72677379 nonsense probably null
R0194:Nedd4 UTSW 9 72670053 missense possibly damaging 0.72
R0714:Nedd4 UTSW 9 72731446 splice site probably benign
R1331:Nedd4 UTSW 9 72677386 missense probably damaging 1.00
R1633:Nedd4 UTSW 9 72671257 missense possibly damaging 0.50
R1764:Nedd4 UTSW 9 72730907 missense probably damaging 0.99
R2192:Nedd4 UTSW 9 72742718 missense probably damaging 0.99
R2196:Nedd4 UTSW 9 72725074 missense possibly damaging 0.77
R2220:Nedd4 UTSW 9 72736707 missense probably damaging 1.00
R2850:Nedd4 UTSW 9 72725074 missense possibly damaging 0.77
R2994:Nedd4 UTSW 9 72730903 missense probably benign 0.04
R3040:Nedd4 UTSW 9 72669961 missense probably benign
R3697:Nedd4 UTSW 9 72740187 missense probably damaging 1.00
R3884:Nedd4 UTSW 9 72725077 missense probably benign 0.16
R4475:Nedd4 UTSW 9 72671239 nonsense probably null
R4476:Nedd4 UTSW 9 72671239 nonsense probably null
R4883:Nedd4 UTSW 9 72740233 splice site probably null
R5066:Nedd4 UTSW 9 72710519 missense probably damaging 1.00
R5947:Nedd4 UTSW 9 72730850 intron probably benign
R5974:Nedd4 UTSW 9 72743638 critical splice donor site probably null
R6247:Nedd4 UTSW 9 72726438 missense probably damaging 1.00
R6651:Nedd4 UTSW 9 72731271 missense possibly damaging 0.49
R6661:Nedd4 UTSW 9 72686095 missense probably damaging 1.00
R7170:Nedd4 UTSW 9 72670099 missense probably benign 0.00
R7237:Nedd4 UTSW 9 72725064 missense probably benign 0.04
R7653:Nedd4 UTSW 9 72743628 missense probably damaging 1.00
R7772:Nedd4 UTSW 9 72677326 missense possibly damaging 0.77
R7905:Nedd4 UTSW 9 72677379 nonsense probably null
R8194:Nedd4 UTSW 9 72686107 missense probably damaging 1.00
R8229:Nedd4 UTSW 9 72731388 missense probably benign 0.00
R8487:Nedd4 UTSW 9 72670039 missense probably damaging 0.98
R8733:Nedd4 UTSW 9 72726484 missense possibly damaging 0.80
Z1088:Nedd4 UTSW 9 72670078 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GCTCTATGTTAAAACAGCTTTGGC -3'
(R):5'- AATGTGCCCATCTCAGTGC -3'

Sequencing Primer
(F):5'- TGGATGTCCCAGCACTGAG -3'
(R):5'- ATCTCAGTGCACCCTGAATG -3'
Posted On2020-10-20