Incidental Mutation 'R8422:Tanc2'
ID653269
Institutional Source Beutler Lab
Gene Symbol Tanc2
Ensembl Gene ENSMUSG00000053580
Gene Nametetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms5730590C14Rik, 3526402J09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8422 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location105589986-105929304 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105835188 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 393 (M393V)
Ref Sequence ENSEMBL: ENSMUSP00000097904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100330]
Predicted Effect probably benign
Transcript: ENSMUST00000100330
AA Change: M393V

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097904
Gene: ENSMUSG00000053580
AA Change: M393V

DomainStartEndE-ValueType
low complexity region 32 50 N/A INTRINSIC
low complexity region 129 152 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 436 447 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
ANK 846 878 2.08e3 SMART
ANK 882 913 2.97e2 SMART
ANK 917 946 5.75e-1 SMART
ANK 950 979 8.62e1 SMART
ANK 990 1018 1.16e3 SMART
ANK 1033 1062 3.31e-1 SMART
ANK 1066 1095 7.71e-2 SMART
ANK 1099 1128 6.12e-5 SMART
ANK 1132 1161 8.99e-3 SMART
ANK 1165 1194 5.71e-5 SMART
ANK 1198 1227 2.11e2 SMART
TPR 1244 1277 3.89e1 SMART
TPR 1291 1324 3.61e-2 SMART
TPR 1325 1358 2.82e-4 SMART
low complexity region 1369 1406 N/A INTRINSIC
low complexity region 1533 1539 N/A INTRINSIC
low complexity region 1787 1802 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap vector die prior to E12. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,662,297 S570R possibly damaging Het
4921517D22Rik T C 13: 59,691,629 M1V probably null Het
4921524J17Rik T G 8: 85,412,289 K57T possibly damaging Het
4930596D02Rik G T 14: 35,810,052 Q189K probably benign Het
Anapc1 T C 2: 128,675,837 T296A probably benign Het
Aqp7 T A 4: 41,035,622 M78L probably benign Het
C1qtnf5 C A 9: 44,108,664 A195E possibly damaging Het
Calhm2 T C 19: 47,133,140 I197V probably benign Het
Ccdc186 G A 19: 56,813,185 L167F probably benign Het
Ccr3 T C 9: 124,028,762 Y45H probably damaging Het
Cct3 G C 3: 88,300,819 R38P probably damaging Het
Clstn2 T C 9: 97,458,186 D711G probably benign Het
Dab2ip T A 2: 35,707,755 I157N probably damaging Het
Dchs2 T C 3: 83,325,263 V2185A probably benign Het
Dis3l2 A G 1: 86,854,377 T219A probably benign Het
F2rl3 G T 8: 72,763,185 V347L probably benign Het
Fastkd1 A G 2: 69,702,434 S530P probably damaging Het
Fgfr3 T A 5: 33,734,905 Y689* probably null Het
Gm10521 A G 1: 171,896,459 I112M unknown Het
Gm9736 C A 10: 77,750,880 V159F unknown Het
Hba-x A T 11: 32,277,736 H88L probably benign Het
Il12rb2 A T 6: 67,360,816 V27E probably benign Het
Imp4 G T 1: 34,443,916 G196V probably damaging Het
Itga11 A C 9: 62,767,678 I831L probably benign Het
Macf1 C T 4: 123,409,486 V408I possibly damaging Het
Nedd4 T A 9: 72,742,682 D771E probably damaging Het
Noc3l T C 19: 38,807,103 Y413C probably benign Het
Npas3 C A 12: 54,068,509 T738K probably benign Het
Ntrk2 A T 13: 58,985,901 D498V probably damaging Het
Nyap1 T C 5: 137,735,821 T317A probably benign Het
Olfr1212 T C 2: 88,958,997 M177T probably benign Het
Olfr294 T A 7: 86,616,258 H129L probably benign Het
Olfr74 T A 2: 87,973,799 I289L probably benign Het
Olfr978 T C 9: 39,994,554 L248P probably damaging Het
Pcdhb20 A T 18: 37,504,796 D125V probably damaging Het
Phc3 G A 3: 30,929,890 Q692* probably null Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Ppp1r12a T A 10: 108,241,181 H339Q probably benign Het
Ppp1r3a G A 6: 14,718,435 Q827* probably null Het
Ptpra T A 2: 130,532,171 I265N possibly damaging Het
Rabggta G T 14: 55,718,458 H447Q probably benign Het
Ralgps1 T C 2: 33,172,430 D277G possibly damaging Het
Riok3 A T 18: 12,136,812 E100V probably null Het
Rtcb C T 10: 85,943,304 V362M probably benign Het
Scd2 G T 19: 44,301,304 C246F probably benign Het
Slco6c1 T C 1: 97,125,783 E131G probably damaging Het
Tas2r136 A T 6: 132,777,327 I279N probably damaging Het
Tbx3 G T 5: 119,680,516 K405N possibly damaging Het
Thumpd2 A T 17: 81,026,944 V405D probably damaging Het
Tlr12 A G 4: 128,616,634 S608P probably damaging Het
Wfs1 T C 5: 36,973,875 K165E probably benign Het
Zfp810 C A 9: 22,283,222 E57* probably null Het
Other mutations in Tanc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Tanc2 APN 11 105923220 missense probably benign 0.28
IGL00688:Tanc2 APN 11 105798690 missense probably damaging 1.00
IGL00709:Tanc2 APN 11 105798795 missense probably damaging 1.00
IGL01013:Tanc2 APN 11 105625065 missense probably damaging 0.96
IGL01141:Tanc2 APN 11 105886474 splice site probably benign
IGL01386:Tanc2 APN 11 105886381 missense probably damaging 0.99
IGL01433:Tanc2 APN 11 105810522 missense possibly damaging 0.75
IGL01562:Tanc2 APN 11 105780069 missense probably benign 0.00
IGL01979:Tanc2 APN 11 105776920 missense probably benign
IGL02104:Tanc2 APN 11 105780133 unclassified probably benign
IGL02434:Tanc2 APN 11 105780042 missense probably benign 0.14
IGL02534:Tanc2 APN 11 105835168 missense probably damaging 1.00
IGL02568:Tanc2 APN 11 105776951 missense probably benign 0.00
IGL03279:Tanc2 APN 11 105913092 splice site probably null
R0595:Tanc2 UTSW 11 105714177 splice site probably null
R1131:Tanc2 UTSW 11 105835002 missense probably damaging 1.00
R1320:Tanc2 UTSW 11 105886444 missense probably damaging 1.00
R1487:Tanc2 UTSW 11 105923634 missense probably damaging 0.99
R1497:Tanc2 UTSW 11 105922137 missense probably benign 0.21
R1692:Tanc2 UTSW 11 105857500 missense probably benign
R1712:Tanc2 UTSW 11 105899780 missense probably benign
R1793:Tanc2 UTSW 11 105625033 critical splice acceptor site probably null
R1812:Tanc2 UTSW 11 105886386 missense probably benign 0.01
R1905:Tanc2 UTSW 11 105922863 missense possibly damaging 0.61
R1959:Tanc2 UTSW 11 105910295 missense probably damaging 1.00
R1962:Tanc2 UTSW 11 105798732 missense probably benign 0.14
R2122:Tanc2 UTSW 11 105895949 missense probably damaging 1.00
R2174:Tanc2 UTSW 11 105910309 missense probably benign 0.00
R2341:Tanc2 UTSW 11 105835051 missense probably benign 0.09
R2497:Tanc2 UTSW 11 105673493 critical splice donor site probably null
R3438:Tanc2 UTSW 11 105857575 missense probably damaging 0.97
R3711:Tanc2 UTSW 11 105798690 missense probably damaging 1.00
R3765:Tanc2 UTSW 11 105914970 missense probably damaging 1.00
R3890:Tanc2 UTSW 11 105798678 missense probably damaging 1.00
R4193:Tanc2 UTSW 11 105914062 intron probably benign
R4609:Tanc2 UTSW 11 105910240 missense probably benign 0.24
R4674:Tanc2 UTSW 11 105867480 missense probably damaging 1.00
R4928:Tanc2 UTSW 11 105867762 missense probably damaging 1.00
R5008:Tanc2 UTSW 11 105625060 start codon destroyed probably null 0.46
R5010:Tanc2 UTSW 11 105780092 missense probably damaging 1.00
R5135:Tanc2 UTSW 11 105857553 missense possibly damaging 0.93
R5385:Tanc2 UTSW 11 105776846 missense probably damaging 0.99
R5409:Tanc2 UTSW 11 105867485 missense possibly damaging 0.93
R5419:Tanc2 UTSW 11 105922883 missense probably benign 0.00
R5501:Tanc2 UTSW 11 105914985 critical splice donor site probably null
R5590:Tanc2 UTSW 11 105923306 missense probably damaging 0.99
R5651:Tanc2 UTSW 11 105798700 missense probably benign 0.44
R5798:Tanc2 UTSW 11 105921855 small deletion probably benign
R5876:Tanc2 UTSW 11 105922613 missense possibly damaging 0.71
R5889:Tanc2 UTSW 11 105921807 missense probably benign 0.23
R5958:Tanc2 UTSW 11 105840625 missense probably benign 0.00
R5999:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6024:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6024:Tanc2 UTSW 11 105923672 missense probably damaging 1.00
R6025:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6025:Tanc2 UTSW 11 105896547 missense possibly damaging 0.68
R6048:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6049:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6185:Tanc2 UTSW 11 105913039 missense probably damaging 1.00
R6335:Tanc2 UTSW 11 105857556 missense probably damaging 0.99
R6821:Tanc2 UTSW 11 105886490 splice site probably null
R6846:Tanc2 UTSW 11 105798653 missense probably benign 0.34
R6857:Tanc2 UTSW 11 105910288 missense possibly damaging 0.81
R6904:Tanc2 UTSW 11 105835230 missense possibly damaging 0.89
R7009:Tanc2 UTSW 11 105840699 missense possibly damaging 0.47
R7017:Tanc2 UTSW 11 105923108 missense probably benign
R7371:Tanc2 UTSW 11 105798596 missense probably benign
R7556:Tanc2 UTSW 11 105909031 missense
R7630:Tanc2 UTSW 11 105776908 missense probably benign 0.04
R7693:Tanc2 UTSW 11 105923467 missense probably damaging 1.00
R7757:Tanc2 UTSW 11 105776858 missense possibly damaging 0.81
R7807:Tanc2 UTSW 11 105867654 missense probably benign 0.00
R7878:Tanc2 UTSW 11 105913415 missense
R7895:Tanc2 UTSW 11 105921825 missense probably damaging 1.00
R7952:Tanc2 UTSW 11 105896597 missense probably damaging 1.00
R8099:Tanc2 UTSW 11 105864007 missense probably benign 0.17
R8117:Tanc2 UTSW 11 105835162 missense probably damaging 1.00
R8133:Tanc2 UTSW 11 105923222 missense probably damaging 0.97
R8527:Tanc2 UTSW 11 105917008 missense probably damaging 0.96
R8542:Tanc2 UTSW 11 105917008 missense probably damaging 0.96
X0027:Tanc2 UTSW 11 105835183 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GACCTCCAGACATCTCCTTGAAG -3'
(R):5'- TGCACCAAGGTCCTCACATG -3'

Sequencing Primer
(F):5'- GAAGCCCCTACTCTTCGAAGTG -3'
(R):5'- AAGGTCCTCACATGGTGCAG -3'
Posted On2020-10-20