Incidental Mutation 'R8422:Rabggta'
ID653275
Institutional Source Beutler Lab
Gene Symbol Rabggta
Ensembl Gene ENSMUSG00000040472
Gene NameRab geranylgeranyl transferase, a subunit
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R8422 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location55715416-55722263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55718458 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 447 (H447Q)
Ref Sequence ENSEMBL: ENSMUSP00000128668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062861] [ENSMUST00000163889] [ENSMUST00000168729] [ENSMUST00000169237] [ENSMUST00000178034] [ENSMUST00000227061] [ENSMUST00000227958] [ENSMUST00000228123]
Predicted Effect probably benign
Transcript: ENSMUST00000062861
AA Change: H177Q

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000061498
Gene: ENSMUSG00000040472
AA Change: H177Q

DomainStartEndE-ValueType
Pfam:PPTA 47 77 2.9e-8 PFAM
Pfam:PPTA 91 121 2e-12 PFAM
Pfam:PPTA 127 156 7.6e-11 PFAM
Pfam:PPTA 162 192 3.8e-12 PFAM
Pfam:PPTA 210 240 7.8e-12 PFAM
Pfam:RabGGT_insert 243 346 5.3e-47 PFAM
LRR 462 485 1.62e0 SMART
LRR 507 531 1.03e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163889
AA Change: H447Q

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128668
Gene: ENSMUSG00000040472
AA Change: H447Q

DomainStartEndE-ValueType
Pfam:PPTA 47 77 2.9e-8 PFAM
Pfam:PPTA 91 121 2e-12 PFAM
Pfam:PPTA 127 156 7.6e-11 PFAM
Pfam:PPTA 162 192 3.8e-12 PFAM
Pfam:PPTA 210 240 7.8e-12 PFAM
Pfam:RabGGT_insert 243 346 5.3e-47 PFAM
LRR 462 485 1.62e0 SMART
LRR 507 531 1.03e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168729
SMART Domains Protein: ENSMUSP00000128090
Gene: ENSMUSG00000022218

DomainStartEndE-ValueType
low complexity region 13 45 N/A INTRINSIC
low complexity region 50 63 N/A INTRINSIC
low complexity region 65 95 N/A INTRINSIC
Pfam:Transglut_N 109 228 5.5e-35 PFAM
TGc 368 461 1.7e-43 SMART
low complexity region 550 561 N/A INTRINSIC
Pfam:Transglut_C 578 682 1.5e-22 PFAM
Pfam:Transglut_C 690 787 1e-20 PFAM
low complexity region 788 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169237
AA Change: H447Q

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133032
Gene: ENSMUSG00000040472
AA Change: H447Q

DomainStartEndE-ValueType
Pfam:PPTA 92 119 3.6e-12 PFAM
Pfam:PPTA 128 154 1.2e-10 PFAM
Pfam:PPTA 163 190 2e-11 PFAM
Pfam:PPTA 211 238 9e-12 PFAM
Pfam:RabGGT_insert 244 346 1.9e-46 PFAM
LRR 462 485 1.62e0 SMART
LRR 507 531 1.03e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178034
SMART Domains Protein: ENSMUSP00000137642
Gene: ENSMUSG00000022218

DomainStartEndE-ValueType
low complexity region 13 45 N/A INTRINSIC
low complexity region 50 63 N/A INTRINSIC
low complexity region 65 95 N/A INTRINSIC
Pfam:Transglut_N 110 226 1.2e-32 PFAM
TGc 368 461 1.7e-43 SMART
low complexity region 550 561 N/A INTRINSIC
Pfam:Transglut_C 578 682 3.6e-24 PFAM
Pfam:Transglut_C 690 787 1.3e-20 PFAM
low complexity region 788 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227061
AA Change: H447Q

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000227958
Predicted Effect probably benign
Transcript: ENSMUST00000228123
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes exhibit diluted pigmentation, a platelet defect resulting in prolonged bleeding, macrothrombocytopenia, impaired killing by cytotoxic T lymphocytes, high mortality, and poor breeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,662,297 S570R possibly damaging Het
4921517D22Rik T C 13: 59,691,629 M1V probably null Het
4921524J17Rik T G 8: 85,412,289 K57T possibly damaging Het
4930596D02Rik G T 14: 35,810,052 Q189K probably benign Het
Anapc1 T C 2: 128,675,837 T296A probably benign Het
Aqp7 T A 4: 41,035,622 M78L probably benign Het
C1qtnf5 C A 9: 44,108,664 A195E possibly damaging Het
Calhm2 T C 19: 47,133,140 I197V probably benign Het
Ccdc186 G A 19: 56,813,185 L167F probably benign Het
Ccr3 T C 9: 124,028,762 Y45H probably damaging Het
Cct3 G C 3: 88,300,819 R38P probably damaging Het
Clstn2 T C 9: 97,458,186 D711G probably benign Het
Dab2ip T A 2: 35,707,755 I157N probably damaging Het
Dchs2 T C 3: 83,325,263 V2185A probably benign Het
Dis3l2 A G 1: 86,854,377 T219A probably benign Het
F2rl3 G T 8: 72,763,185 V347L probably benign Het
Fastkd1 A G 2: 69,702,434 S530P probably damaging Het
Fgfr3 T A 5: 33,734,905 Y689* probably null Het
Gm10521 A G 1: 171,896,459 I112M unknown Het
Gm9736 C A 10: 77,750,880 V159F unknown Het
Hba-x A T 11: 32,277,736 H88L probably benign Het
Il12rb2 A T 6: 67,360,816 V27E probably benign Het
Imp4 G T 1: 34,443,916 G196V probably damaging Het
Itga11 A C 9: 62,767,678 I831L probably benign Het
Macf1 C T 4: 123,409,486 V408I possibly damaging Het
Nedd4 T A 9: 72,742,682 D771E probably damaging Het
Noc3l T C 19: 38,807,103 Y413C probably benign Het
Npas3 C A 12: 54,068,509 T738K probably benign Het
Ntrk2 A T 13: 58,985,901 D498V probably damaging Het
Nyap1 T C 5: 137,735,821 T317A probably benign Het
Olfr1212 T C 2: 88,958,997 M177T probably benign Het
Olfr294 T A 7: 86,616,258 H129L probably benign Het
Olfr74 T A 2: 87,973,799 I289L probably benign Het
Olfr978 T C 9: 39,994,554 L248P probably damaging Het
Pcdhb20 A T 18: 37,504,796 D125V probably damaging Het
Phc3 G A 3: 30,929,890 Q692* probably null Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Ppp1r12a T A 10: 108,241,181 H339Q probably benign Het
Ppp1r3a G A 6: 14,718,435 Q827* probably null Het
Ptpra T A 2: 130,532,171 I265N possibly damaging Het
Ralgps1 T C 2: 33,172,430 D277G possibly damaging Het
Riok3 A T 18: 12,136,812 E100V probably null Het
Rtcb C T 10: 85,943,304 V362M probably benign Het
Scd2 G T 19: 44,301,304 C246F probably benign Het
Slco6c1 T C 1: 97,125,783 E131G probably damaging Het
Tanc2 A G 11: 105,835,188 M393V probably benign Het
Tas2r136 A T 6: 132,777,327 I279N probably damaging Het
Tbx3 G T 5: 119,680,516 K405N possibly damaging Het
Thumpd2 A T 17: 81,026,944 V405D probably damaging Het
Tlr12 A G 4: 128,616,634 S608P probably damaging Het
Wfs1 T C 5: 36,973,875 K165E probably benign Het
Zfp810 C A 9: 22,283,222 E57* probably null Het
Other mutations in Rabggta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01876:Rabggta APN 14 55718671 missense probably damaging 0.98
IGL02263:Rabggta APN 14 55718961 splice site probably benign
IGL02293:Rabggta APN 14 55721696 missense probably benign 0.27
IGL02377:Rabggta APN 14 55718495 missense possibly damaging 0.66
IGL02901:Rabggta APN 14 55721681 missense probably benign 0.41
IGL03004:Rabggta APN 14 55719230 splice site probably benign
R0334:Rabggta UTSW 14 55720811 missense probably damaging 1.00
R1914:Rabggta UTSW 14 55721189 missense possibly damaging 0.73
R2926:Rabggta UTSW 14 55719290 missense probably benign 0.00
R4469:Rabggta UTSW 14 55716487 missense probably benign 0.00
R5584:Rabggta UTSW 14 55720832 missense probably benign
R6721:Rabggta UTSW 14 55717203 missense probably damaging 1.00
R6960:Rabggta UTSW 14 55721842 critical splice donor site probably null
R7169:Rabggta UTSW 14 55720901 missense probably damaging 0.99
R7447:Rabggta UTSW 14 55719316 missense probably null 0.11
R7805:Rabggta UTSW 14 55719512 missense probably benign 0.00
R8038:Rabggta UTSW 14 55718930 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CAATGAGCTACACATTCCTAGTCC -3'
(R):5'- AAAGCAAGTTGGGCCTTGGG -3'

Sequencing Primer
(F):5'- ACATTCCTAGTCCAGCTTTGATGGG -3'
(R):5'- TGGGCCTTGGGGAAGAC -3'
Posted On2020-10-20