Incidental Mutation 'R8423:Carf'
ID653285
Institutional Source Beutler Lab
Gene Symbol Carf
Ensembl Gene ENSMUSG00000026017
Gene Namecalcium response factor
SynonymsAls2cr8
Accession Numbers

Genbank: NM_139150; MGI: 2182269

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8423 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location60098247-60153953 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 60150593 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 659 (L659Q)
Ref Sequence ENSEMBL: ENSMUSP00000137825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027171] [ENSMUST00000130075] [ENSMUST00000180952] [ENSMUST00000186107] [ENSMUST00000187978]
Predicted Effect probably damaging
Transcript: ENSMUST00000027171
AA Change: L624Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027171
Gene: ENSMUSG00000026017
AA Change: L624Q

DomainStartEndE-ValueType
Pfam:ALS2CR8 227 457 6.4e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130075
Predicted Effect probably benign
Transcript: ENSMUST00000132949
Predicted Effect possibly damaging
Transcript: ENSMUST00000180952
AA Change: L659Q

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137825
Gene: ENSMUSG00000026017
AA Change: L659Q

DomainStartEndE-ValueType
Pfam:ALS2CR8 224 458 1.2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186107
SMART Domains Protein: ENSMUSP00000139554
Gene: ENSMUSG00000026017

DomainStartEndE-ValueType
low complexity region 239 255 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187978
AA Change: L659Q

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141169
Gene: ENSMUSG00000026017
AA Change: L659Q

DomainStartEndE-ValueType
Pfam:ALS2CR8 224 458 1.2e-64 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele have aberrant learning and memory. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(2)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A G 12: 113,490,910 D449G possibly damaging Het
Ampd1 T C 3: 103,080,989 S83P probably benign Het
Bub1 G A 2: 127,807,830 L703F probably benign Het
C1rb T A 6: 124,574,658 D242E probably damaging Het
Carmil3 A G 14: 55,499,065 N662S probably damaging Het
Ccno A G 13: 112,988,144 S83G possibly damaging Het
Chd3 A T 11: 69,354,426 Y1155* probably null Het
Clec16a A G 16: 10,576,663 E295G probably benign Het
Clnk A G 5: 38,794,910 probably null Het
Clvs2 T C 10: 33,622,859 D25G possibly damaging Het
Cnr2 C T 4: 135,917,516 R302W probably damaging Het
Dclk3 C T 9: 111,468,719 R444W possibly damaging Het
Dmxl1 T C 18: 49,865,116 V761A probably damaging Het
Dnah7a C A 1: 53,472,904 K2999N possibly damaging Het
Dusp28 T C 1: 92,907,184 S44P probably damaging Het
Enpep T G 3: 129,309,125 N394T probably damaging Het
Fam135a A T 1: 24,021,917 F1343I probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fbxo40 A T 16: 36,970,585 H54Q probably damaging Het
Galnt9 A G 5: 110,596,245 D315G probably benign Het
Gbp4 T A 5: 105,119,934 D482V probably damaging Het
Gm17175 T A 14: 51,571,613 I99F possibly damaging Het
Gm340 T C 19: 41,585,449 I881T possibly damaging Het
Heatr4 A G 12: 83,980,330 F51S probably benign Het
Herc1 T C 9: 66,508,160 S4806P probably damaging Het
Hoxc11 G A 15: 102,954,742 V73I possibly damaging Het
Knl1 T G 2: 119,070,032 I738S probably damaging Het
Lipt2 T C 7: 100,160,243 F179S probably damaging Het
Lrrc8b G A 5: 105,480,756 V323M probably damaging Het
Ltbp1 T C 17: 75,292,857 S665P probably benign Het
Miga1 A T 3: 152,322,408 D161E probably benign Het
Mynn A G 3: 30,603,784 T84A probably benign Het
Olfr1248 A T 2: 89,617,987 D68E probably damaging Het
Olfr159 T C 4: 43,770,598 S138G possibly damaging Het
Olfr401 T C 11: 74,121,666 F126L probably benign Het
Pik3r3 C T 4: 116,222,375 S23L probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ralgapa1 A G 12: 55,659,062 S1892P probably damaging Het
Slc6a18 T A 13: 73,665,574 Q540L probably benign Het
Tfap2a A T 13: 40,719,230 N323K possibly damaging Het
Tgm1 A T 14: 55,705,643 M580K probably benign Het
Tnrc6b G A 15: 80,929,418 G1792D unknown Het
Trim66 T A 7: 109,475,392 Q554L possibly damaging Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn1r238 G T 18: 3,123,365 C16* probably null Het
Vmn1r6 G A 6: 57,002,510 M52I probably benign Het
Zfp61 A G 7: 24,292,034 F231L probably benign Het
Other mutations in Carf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Carf APN 1 60124842 splice site probably benign
IGL00730:Carf APN 1 60147418 nonsense probably null
IGL00792:Carf APN 1 60126009 missense possibly damaging 0.73
IGL00913:Carf APN 1 60147955 missense probably benign 0.20
IGL01487:Carf APN 1 60109379 missense probably damaging 1.00
IGL02214:Carf APN 1 60148081 missense probably damaging 1.00
IGL03258:Carf APN 1 60109229 missense possibly damaging 0.93
IGL03285:Carf APN 1 60146154 missense probably damaging 1.00
3-1:Carf UTSW 1 60141468 missense possibly damaging 0.93
PIT4283001:Carf UTSW 1 60128002 missense probably benign 0.32
R0375:Carf UTSW 1 60144002 missense probably damaging 1.00
R0465:Carf UTSW 1 60131983 missense probably damaging 1.00
R0591:Carf UTSW 1 60125914 splice site probably benign
R1158:Carf UTSW 1 60147839 missense probably benign 0.22
R1433:Carf UTSW 1 60124858 missense probably damaging 1.00
R1464:Carf UTSW 1 60125906 splice site probably benign
R1467:Carf UTSW 1 60127993 missense possibly damaging 0.58
R1467:Carf UTSW 1 60127993 missense possibly damaging 0.58
R1546:Carf UTSW 1 60126036 critical splice donor site probably null
R1801:Carf UTSW 1 60141505 missense possibly damaging 0.60
R1977:Carf UTSW 1 60146136 missense probably damaging 1.00
R2086:Carf UTSW 1 60109411 missense probably damaging 1.00
R2163:Carf UTSW 1 60147486 splice site probably benign
R2198:Carf UTSW 1 60141484 missense probably damaging 1.00
R2238:Carf UTSW 1 60148034 missense probably benign
R2981:Carf UTSW 1 60139232 missense probably damaging 1.00
R4090:Carf UTSW 1 60136347 missense possibly damaging 0.94
R4573:Carf UTSW 1 60148112 missense probably benign 0.39
R4737:Carf UTSW 1 60109318 missense probably benign 0.00
R4906:Carf UTSW 1 60141367 missense probably damaging 1.00
R4965:Carf UTSW 1 60150637 missense probably damaging 0.99
R5080:Carf UTSW 1 60150613 missense probably damaging 0.98
R5184:Carf UTSW 1 60108174 missense probably damaging 0.99
R5949:Carf UTSW 1 60139313 missense probably damaging 1.00
R6135:Carf UTSW 1 60147963 missense probably damaging 1.00
R6346:Carf UTSW 1 60141540 nonsense probably null
R6886:Carf UTSW 1 60136254 splice site probably null
R7115:Carf UTSW 1 60148150 missense probably damaging 1.00
R7228:Carf UTSW 1 60109394 missense probably damaging 0.99
R7459:Carf UTSW 1 60128039 missense possibly damaging 0.93
R7755:Carf UTSW 1 60148055 missense probably benign 0.00
R7809:Carf UTSW 1 60144067 missense probably damaging 0.98
R8053:Carf UTSW 1 60128038 missense probably benign 0.42
R8137:Carf UTSW 1 60147965 missense probably benign 0.00
Z1177:Carf UTSW 1 60136262 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTGTCACCATGACCCTTTCG -3'
(R):5'- CCAGTGATTGATACACCATCTCAG -3'

Sequencing Primer
(F):5'- TAGATCAGGCCAGCCTTGTG -3'
(R):5'- TGATTGATACACCATCTCAGACAATC -3'
Posted On2020-10-20