Incidental Mutation 'R8423:Ampd1'
ID653291
Institutional Source Beutler Lab
Gene Symbol Ampd1
Ensembl Gene ENSMUSG00000070385
Gene Nameadenosine monophosphate deaminase 1
SynonymsAmpd-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R8423 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location103074014-103099720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103080989 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 83 (S83P)
Ref Sequence ENSEMBL: ENSMUSP00000088217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090715] [ENSMUST00000155034] [ENSMUST00000176440]
Predicted Effect probably benign
Transcript: ENSMUST00000090715
AA Change: S83P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088217
Gene: ENSMUSG00000070385
AA Change: S83P

DomainStartEndE-ValueType
low complexity region 234 246 N/A INTRINSIC
Pfam:A_deaminase 294 701 5.4e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155034
AA Change: S83P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143129
Gene: ENSMUSG00000070385
AA Change: S83P

DomainStartEndE-ValueType
low complexity region 234 246 N/A INTRINSIC
Pfam:A_deaminase 294 676 5.2e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176440
AA Change: S79P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenosine monophosphate deaminase 1 catalyzes the deamination of AMP to IMP in skeletal muscle and plays an important role in the purine nucleotide cycle. Two other genes have been identified, AMPD2 and AMPD3, for the liver- and erythocyte-specific isoforms, respectively. Deficiency of the muscle-specific enzyme is apparently a common cause of exercise-induced myopathy and probably the most common cause of metabolic myopathy in the human. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A G 12: 113,490,910 D449G possibly damaging Het
Bub1 G A 2: 127,807,830 L703F probably benign Het
C1rb T A 6: 124,574,658 D242E probably damaging Het
Carf T A 1: 60,150,593 L659Q possibly damaging Het
Carmil3 A G 14: 55,499,065 N662S probably damaging Het
Ccno A G 13: 112,988,144 S83G possibly damaging Het
Chd3 A T 11: 69,354,426 Y1155* probably null Het
Clec16a A G 16: 10,576,663 E295G probably benign Het
Clnk A G 5: 38,794,910 probably null Het
Clvs2 T C 10: 33,622,859 D25G possibly damaging Het
Cnr2 C T 4: 135,917,516 R302W probably damaging Het
Dclk3 C T 9: 111,468,719 R444W possibly damaging Het
Dmxl1 T C 18: 49,865,116 V761A probably damaging Het
Dnah7a C A 1: 53,472,904 K2999N possibly damaging Het
Dusp28 T C 1: 92,907,184 S44P probably damaging Het
Enpep T G 3: 129,309,125 N394T probably damaging Het
Fam135a A T 1: 24,021,917 F1343I probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fbxo40 A T 16: 36,970,585 H54Q probably damaging Het
Galnt9 A G 5: 110,596,245 D315G probably benign Het
Gbp4 T A 5: 105,119,934 D482V probably damaging Het
Gm17175 T A 14: 51,571,613 I99F possibly damaging Het
Gm340 T C 19: 41,585,449 I881T possibly damaging Het
Heatr4 A G 12: 83,980,330 F51S probably benign Het
Herc1 T C 9: 66,508,160 S4806P probably damaging Het
Hoxc11 G A 15: 102,954,742 V73I possibly damaging Het
Knl1 T G 2: 119,070,032 I738S probably damaging Het
Lipt2 T C 7: 100,160,243 F179S probably damaging Het
Lrrc8b G A 5: 105,480,756 V323M probably damaging Het
Ltbp1 T C 17: 75,292,857 S665P probably benign Het
Miga1 A T 3: 152,322,408 D161E probably benign Het
Mynn A G 3: 30,603,784 T84A probably benign Het
Olfr1248 A T 2: 89,617,987 D68E probably damaging Het
Olfr159 T C 4: 43,770,598 S138G possibly damaging Het
Olfr401 T C 11: 74,121,666 F126L probably benign Het
Pik3r3 C T 4: 116,222,375 S23L probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ralgapa1 A G 12: 55,659,062 S1892P probably damaging Het
Slc6a18 T A 13: 73,665,574 Q540L probably benign Het
Tfap2a A T 13: 40,719,230 N323K possibly damaging Het
Tgm1 A T 14: 55,705,643 M580K probably benign Het
Tnrc6b G A 15: 80,929,418 G1792D unknown Het
Trim66 T A 7: 109,475,392 Q554L possibly damaging Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn1r238 G T 18: 3,123,365 C16* probably null Het
Vmn1r6 G A 6: 57,002,510 M52I probably benign Het
Zfp61 A G 7: 24,292,034 F231L probably benign Het
Other mutations in Ampd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Ampd1 APN 3 103099694 missense possibly damaging 0.64
IGL00909:Ampd1 APN 3 103088428 missense probably benign 0.10
IGL01543:Ampd1 APN 3 103095713 missense probably benign 0.00
IGL01743:Ampd1 APN 3 103094885 splice site probably benign
IGL02390:Ampd1 APN 3 103079041 missense probably benign 0.28
IGL02637:Ampd1 APN 3 103094883 splice site probably benign
IGL02735:Ampd1 APN 3 103085377 missense probably damaging 1.00
IGL03151:Ampd1 APN 3 103092470 splice site probably null
twinkle_toes UTSW 3 103095646 nonsense probably null
R0158:Ampd1 UTSW 3 103091730 nonsense probably null
R0441:Ampd1 UTSW 3 103088478 missense probably benign 0.05
R0646:Ampd1 UTSW 3 103099597 missense probably damaging 1.00
R1474:Ampd1 UTSW 3 103098838 missense probably damaging 1.00
R1499:Ampd1 UTSW 3 103091664 missense probably damaging 1.00
R1789:Ampd1 UTSW 3 103099126 missense possibly damaging 0.46
R2131:Ampd1 UTSW 3 103094878 critical splice donor site probably null
R3706:Ampd1 UTSW 3 103088311 splice site probably benign
R4007:Ampd1 UTSW 3 103092460 missense probably damaging 0.99
R4169:Ampd1 UTSW 3 103094841 missense probably damaging 1.00
R4525:Ampd1 UTSW 3 103094733 missense probably damaging 1.00
R4828:Ampd1 UTSW 3 103081097 missense probably damaging 1.00
R5015:Ampd1 UTSW 3 103099665 missense possibly damaging 0.89
R5514:Ampd1 UTSW 3 103079172 missense possibly damaging 0.50
R5839:Ampd1 UTSW 3 103085428 missense possibly damaging 0.47
R5872:Ampd1 UTSW 3 103079130 missense probably benign 0.00
R5890:Ampd1 UTSW 3 103090075 missense probably damaging 1.00
R5986:Ampd1 UTSW 3 103085397 missense probably damaging 1.00
R6272:Ampd1 UTSW 3 103085383 missense possibly damaging 0.50
R6473:Ampd1 UTSW 3 103095646 nonsense probably null
R6504:Ampd1 UTSW 3 103099595 missense possibly damaging 0.90
R7051:Ampd1 UTSW 3 103090073 missense probably damaging 1.00
R7323:Ampd1 UTSW 3 103085380 missense probably benign
R7424:Ampd1 UTSW 3 103088442 missense probably benign 0.05
R7436:Ampd1 UTSW 3 103074119 critical splice donor site probably null
R7546:Ampd1 UTSW 3 103095712 missense probably benign
R8344:Ampd1 UTSW 3 103095686 missense possibly damaging 0.90
R8366:Ampd1 UTSW 3 103088494 missense probably damaging 0.99
R8543:Ampd1 UTSW 3 103079170 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AAAAGCGGCCTTCGAATTTG -3'
(R):5'- CTGTCTTTGGGGACATCTGC -3'

Sequencing Primer
(F):5'- GGTAGTATCTTGTTTCTGACAACCAG -3'
(R):5'- GGACATCTGCACGGCAAAGC -3'
Posted On2020-10-20