Incidental Mutation 'R8423:Clnk'
ID653297
Institutional Source Beutler Lab
Gene Symbol Clnk
Ensembl Gene ENSMUSG00000039315
Gene Namecytokine-dependent hematopoietic cell linker
SynonymsMIST
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8423 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location38706462-38876812 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 38794910 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169819] [ENSMUST00000171633]
Predicted Effect probably null
Transcript: ENSMUST00000169819
SMART Domains Protein: ENSMUSP00000128473
Gene: ENSMUSG00000039315

DomainStartEndE-ValueType
low complexity region 158 188 N/A INTRINSIC
SH2 307 398 3.53e-19 SMART
low complexity region 414 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171633
SMART Domains Protein: ENSMUSP00000132779
Gene: ENSMUSG00000039315

DomainStartEndE-ValueType
low complexity region 158 188 N/A INTRINSIC
SH2 307 398 3.53e-19 SMART
low complexity region 414 427 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MIST is a member of the SLP76 family of adaptors (see LCP2, MIM 601603; BLNK, MIM 604515). MIST plays a role in the regulation of immunoreceptor signaling, including PLC-gamma (PLCG1; MIM 172420)-mediated B cell antigen receptor (BCR) signaling and FC-epsilon R1 (see FCER1A, MIM 147140)-mediated mast cell degranulation (Cao et al., 1999 [PubMed 10562326]; Goitsuka et al., 2000, 2001 [PubMed 10744659] [PubMed 11463797]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a reporter allele display altered natural killer (NK) T cell physiology and enhanced NK cell cytolysis. Mice homozygous for knock-out allele display abnormal mast cell physiology as well as enhanced NK cell cytolysis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A G 12: 113,490,910 D449G possibly damaging Het
Ampd1 T C 3: 103,080,989 S83P probably benign Het
Bub1 G A 2: 127,807,830 L703F probably benign Het
C1rb T A 6: 124,574,658 D242E probably damaging Het
Carf T A 1: 60,150,593 L659Q possibly damaging Het
Carmil3 A G 14: 55,499,065 N662S probably damaging Het
Ccno A G 13: 112,988,144 S83G possibly damaging Het
Chd3 A T 11: 69,354,426 Y1155* probably null Het
Clec16a A G 16: 10,576,663 E295G probably benign Het
Clvs2 T C 10: 33,622,859 D25G possibly damaging Het
Cnr2 C T 4: 135,917,516 R302W probably damaging Het
Dclk3 C T 9: 111,468,719 R444W possibly damaging Het
Dmxl1 T C 18: 49,865,116 V761A probably damaging Het
Dnah7a C A 1: 53,472,904 K2999N possibly damaging Het
Dusp28 T C 1: 92,907,184 S44P probably damaging Het
Enpep T G 3: 129,309,125 N394T probably damaging Het
Fam135a A T 1: 24,021,917 F1343I probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fbxo40 A T 16: 36,970,585 H54Q probably damaging Het
Galnt9 A G 5: 110,596,245 D315G probably benign Het
Gbp4 T A 5: 105,119,934 D482V probably damaging Het
Gm17175 T A 14: 51,571,613 I99F possibly damaging Het
Gm340 T C 19: 41,585,449 I881T possibly damaging Het
Heatr4 A G 12: 83,980,330 F51S probably benign Het
Herc1 T C 9: 66,508,160 S4806P probably damaging Het
Hoxc11 G A 15: 102,954,742 V73I possibly damaging Het
Knl1 T G 2: 119,070,032 I738S probably damaging Het
Lipt2 T C 7: 100,160,243 F179S probably damaging Het
Lrrc8b G A 5: 105,480,756 V323M probably damaging Het
Ltbp1 T C 17: 75,292,857 S665P probably benign Het
Miga1 A T 3: 152,322,408 D161E probably benign Het
Mynn A G 3: 30,603,784 T84A probably benign Het
Olfr1248 A T 2: 89,617,987 D68E probably damaging Het
Olfr159 T C 4: 43,770,598 S138G possibly damaging Het
Olfr401 T C 11: 74,121,666 F126L probably benign Het
Pik3r3 C T 4: 116,222,375 S23L probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ralgapa1 A G 12: 55,659,062 S1892P probably damaging Het
Slc6a18 T A 13: 73,665,574 Q540L probably benign Het
Tfap2a A T 13: 40,719,230 N323K possibly damaging Het
Tgm1 A T 14: 55,705,643 M580K probably benign Het
Tnrc6b G A 15: 80,929,418 G1792D unknown Het
Trim66 T A 7: 109,475,392 Q554L possibly damaging Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn1r238 G T 18: 3,123,365 C16* probably null Het
Vmn1r6 G A 6: 57,002,510 M52I probably benign Het
Zfp61 A G 7: 24,292,034 F231L probably benign Het
Other mutations in Clnk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Clnk APN 5 38784528 missense possibly damaging 0.95
IGL01348:Clnk APN 5 38713207 missense probably damaging 1.00
IGL01901:Clnk APN 5 38794978 missense probably damaging 1.00
IGL01908:Clnk APN 5 38713142 missense probably damaging 1.00
IGL02437:Clnk APN 5 38774566 critical splice donor site probably null
IGL02745:Clnk APN 5 38736319 missense probably benign 0.00
R0138:Clnk UTSW 5 38774608 splice site probably benign
R0196:Clnk UTSW 5 38769939 missense probably damaging 0.97
R1522:Clnk UTSW 5 38794966 missense probably damaging 1.00
R1958:Clnk UTSW 5 38706626 missense possibly damaging 0.96
R2036:Clnk UTSW 5 38752800 splice site probably null
R2238:Clnk UTSW 5 38764351 splice site probably benign
R3788:Clnk UTSW 5 38714998 missense probably damaging 1.00
R3931:Clnk UTSW 5 38768069 missense probably benign
R4159:Clnk UTSW 5 38741795 intron probably benign
R4182:Clnk UTSW 5 38747850 intron probably benign
R4686:Clnk UTSW 5 38741837 intron probably benign
R4751:Clnk UTSW 5 38720913 missense probably benign 0.06
R4842:Clnk UTSW 5 38713069 splice site probably null
R5811:Clnk UTSW 5 38713147 missense probably damaging 1.00
R6236:Clnk UTSW 5 38713199 missense probably benign 0.41
R7157:Clnk UTSW 5 38769891 missense possibly damaging 0.63
R7615:Clnk UTSW 5 38706698 missense probably damaging 1.00
R7618:Clnk UTSW 5 38736355 missense probably benign 0.06
R7762:Clnk UTSW 5 38768141 missense probably benign 0.24
R7768:Clnk UTSW 5 38768158 missense probably damaging 1.00
R7823:Clnk UTSW 5 38750351 missense probably benign 0.00
R8158:Clnk UTSW 5 38794911 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TACACCCTAGCTGGCTATCC -3'
(R):5'- TTTAGCCCCAGTGGAGATGC -3'

Sequencing Primer
(F):5'- CGACTTTGTGAAGTAATCCGATGAG -3'
(R):5'- TTACTCAAATCCGACTGGGGG -3'
Posted On2020-10-20