Incidental Mutation 'R8423:Trim66'
ID653306
Institutional Source Beutler Lab
Gene Symbol Trim66
Ensembl Gene ENSMUSG00000031026
Gene Nametripartite motif-containing 66
SynonymsTif1d, D7H11orf29
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R8423 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location109449006-109508134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109475392 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 554 (Q554L)
Ref Sequence ENSEMBL: ENSMUSP00000102352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033339] [ENSMUST00000106739] [ENSMUST00000106741]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033339
AA Change: Q452L

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000033339
Gene: ENSMUSG00000031026
AA Change: Q452L

DomainStartEndE-ValueType
PHD 4 69 7.77e0 SMART
BBC 108 234 1.61e-39 SMART
low complexity region 318 333 N/A INTRINSIC
low complexity region 452 486 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
PHD 998 1041 4.09e-10 SMART
BROMO 1069 1175 8.22e-27 SMART
low complexity region 1185 1199 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106739
AA Change: Q452L

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102350
Gene: ENSMUSG00000031026
AA Change: Q452L

DomainStartEndE-ValueType
PHD 4 69 7.77e0 SMART
BBC 108 234 1.61e-39 SMART
low complexity region 318 333 N/A INTRINSIC
low complexity region 452 486 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
PHD 998 1041 4.09e-10 SMART
BROMO 1069 1175 8.22e-27 SMART
low complexity region 1185 1199 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106741
AA Change: Q554L

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102352
Gene: ENSMUSG00000031026
AA Change: Q554L

DomainStartEndE-ValueType
RING 28 78 2.38e-2 SMART
BBOX 102 140 1.48e0 SMART
PHD 106 171 7.77e0 SMART
RING 107 170 4.38e0 SMART
BBOX 162 203 4.21e-3 SMART
BBC 210 336 1.61e-39 SMART
low complexity region 420 435 N/A INTRINSIC
low complexity region 554 588 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
PHD 1100 1143 4.09e-10 SMART
BROMO 1171 1277 8.22e-27 SMART
low complexity region 1287 1301 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A G 12: 113,490,910 D449G possibly damaging Het
Ampd1 T C 3: 103,080,989 S83P probably benign Het
Bub1 G A 2: 127,807,830 L703F probably benign Het
C1rb T A 6: 124,574,658 D242E probably damaging Het
Carf T A 1: 60,150,593 L659Q possibly damaging Het
Carmil3 A G 14: 55,499,065 N662S probably damaging Het
Ccno A G 13: 112,988,144 S83G possibly damaging Het
Chd3 A T 11: 69,354,426 Y1155* probably null Het
Clec16a A G 16: 10,576,663 E295G probably benign Het
Clnk A G 5: 38,794,910 probably null Het
Clvs2 T C 10: 33,622,859 D25G possibly damaging Het
Cnr2 C T 4: 135,917,516 R302W probably damaging Het
Col20a1 A G 2: 180,998,705 T594A probably damaging Het
Dclk3 C T 9: 111,468,719 R444W possibly damaging Het
Dmxl1 T C 18: 49,865,116 V761A probably damaging Het
Dnah7a C A 1: 53,472,904 K2999N possibly damaging Het
Dusp28 T C 1: 92,907,184 S44P probably damaging Het
Enpep T G 3: 129,309,125 N394T probably damaging Het
Fam135a A T 1: 24,021,917 F1343I probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fbxo40 A T 16: 36,970,585 H54Q probably damaging Het
Galnt9 A G 5: 110,596,245 D315G probably benign Het
Gbp4 T A 5: 105,119,934 D482V probably damaging Het
Gm17175 T A 14: 51,571,613 I99F possibly damaging Het
Gm340 T C 19: 41,585,449 I881T possibly damaging Het
Heatr4 A G 12: 83,980,330 F51S probably benign Het
Herc1 T C 9: 66,508,160 S4806P probably damaging Het
Hoxc11 G A 15: 102,954,742 V73I possibly damaging Het
Knl1 T G 2: 119,070,032 I738S probably damaging Het
Lipt2 T C 7: 100,160,243 F179S probably damaging Het
Lrrc8b G A 5: 105,480,756 V323M probably damaging Het
Ltbp1 T C 17: 75,292,857 S665P probably benign Het
Miga1 A T 3: 152,322,408 D161E probably benign Het
Mynn A G 3: 30,603,784 T84A probably benign Het
Olfr1248 A T 2: 89,617,987 D68E probably damaging Het
Olfr159 T C 4: 43,770,598 S138G possibly damaging Het
Olfr401 T C 11: 74,121,666 F126L probably benign Het
Pik3r3 C T 4: 116,222,375 S23L probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ralgapa1 A G 12: 55,659,062 S1892P probably damaging Het
Slc6a18 T A 13: 73,665,574 Q540L probably benign Het
Tfap2a A T 13: 40,719,230 N323K possibly damaging Het
Tgm1 A T 14: 55,705,643 M580K probably benign Het
Tnrc6b G A 15: 80,929,418 G1792D unknown Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn1r238 G T 18: 3,123,365 C16* probably null Het
Vmn1r6 G A 6: 57,002,510 M52I probably benign Het
Zfp61 A G 7: 24,292,034 F231L probably benign Het
Other mutations in Trim66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01539:Trim66 APN 7 109455066 missense probably benign 0.02
IGL01758:Trim66 APN 7 109486045 critical splice donor site probably null
IGL01982:Trim66 APN 7 109458763 missense probably benign 0.00
IGL01983:Trim66 APN 7 109458251 nonsense probably null
IGL02149:Trim66 APN 7 109460902 missense possibly damaging 0.66
IGL02392:Trim66 APN 7 109460274 missense probably benign 0.01
IGL02483:Trim66 APN 7 109477630 splice site probably benign
IGL02832:Trim66 APN 7 109460497 missense probably damaging 1.00
IGL02945:Trim66 APN 7 109460176 nonsense probably null
IGL03085:Trim66 APN 7 109458745 missense probably benign 0.17
PIT1430001:Trim66 UTSW 7 109475247 missense probably damaging 0.99
R0326:Trim66 UTSW 7 109460172 missense probably benign 0.00
R0358:Trim66 UTSW 7 109460176 nonsense probably null
R0401:Trim66 UTSW 7 109475264 missense probably damaging 0.98
R0470:Trim66 UTSW 7 109457542 splice site probably benign
R0568:Trim66 UTSW 7 109460695 missense probably benign 0.00
R0669:Trim66 UTSW 7 109454992 intron probably benign
R0980:Trim66 UTSW 7 109455670 missense probably damaging 1.00
R1015:Trim66 UTSW 7 109455233 missense probably damaging 1.00
R1078:Trim66 UTSW 7 109472319 missense probably damaging 1.00
R1099:Trim66 UTSW 7 109475454 missense probably benign 0.34
R1181:Trim66 UTSW 7 109484577 critical splice donor site probably null
R1497:Trim66 UTSW 7 109484619 missense probably benign 0.00
R1583:Trim66 UTSW 7 109455080 missense probably damaging 1.00
R1843:Trim66 UTSW 7 109475839 missense probably damaging 0.99
R1998:Trim66 UTSW 7 109484577 critical splice donor site probably null
R2016:Trim66 UTSW 7 109472232 critical splice donor site probably null
R2143:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R2144:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R2145:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R3945:Trim66 UTSW 7 109472268 missense possibly damaging 0.94
R4012:Trim66 UTSW 7 109458131 missense probably damaging 0.98
R4464:Trim66 UTSW 7 109477690 missense possibly damaging 0.51
R4473:Trim66 UTSW 7 109481995 missense probably damaging 1.00
R4729:Trim66 UTSW 7 109456060 critical splice donor site probably null
R4730:Trim66 UTSW 7 109483069 missense probably damaging 1.00
R4775:Trim66 UTSW 7 109457589 nonsense probably null
R4819:Trim66 UTSW 7 109457586 missense probably damaging 1.00
R5269:Trim66 UTSW 7 109457590 missense probably benign 0.00
R5557:Trim66 UTSW 7 109483737 missense probably benign 0.06
R5832:Trim66 UTSW 7 109455202 missense probably damaging 1.00
R6220:Trim66 UTSW 7 109483093 missense probably damaging 0.97
R6243:Trim66 UTSW 7 109460274 missense probably benign 0.01
R6374:Trim66 UTSW 7 109486062 missense probably benign
R6450:Trim66 UTSW 7 109460738 missense probably benign 0.09
R6543:Trim66 UTSW 7 109475879 missense probably benign 0.01
R6788:Trim66 UTSW 7 109477754 missense probably damaging 1.00
R6842:Trim66 UTSW 7 109460776 missense probably benign 0.00
R7169:Trim66 UTSW 7 109455121 missense probably benign 0.25
R7257:Trim66 UTSW 7 109460244 missense probably damaging 1.00
R7328:Trim66 UTSW 7 109457751 missense probably damaging 0.99
R7616:Trim66 UTSW 7 109483749 missense probably damaging 0.99
R8855:Trim66 UTSW 7 109481981 missense probably damaging 1.00
RF013:Trim66 UTSW 7 109460753 missense probably damaging 0.99
RF024:Trim66 UTSW 7 109460740 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TGACTCAACTGCAGGCTAGG -3'
(R):5'- GAACAGGAGAGTACATCCCAGC -3'

Sequencing Primer
(F):5'- GAGAAGCTCCAAGTCCTTCTG -3'
(R):5'- AGTACATCCCAGCGGCCAG -3'
Posted On2020-10-20