Mutagenetix > Incidental Mutations

Incidental Mutation 'R8423:Carmil3'

653322

Institutional Source

Beutler Lab

Gene Symbol

Carmil3

Ensembl Gene

ENSMUSG00000022211

Gene Name

capping protein regulator and myosin 1 linker 3

Synonyms

Lrrc16b

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.248) question?

Stock #

R8423 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

55490651-55508272 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 55499065 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 662 (N662S)

Ref Sequence

ENSEMBL: ENSMUSP00000075587 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076236] [ENSMUST00000226757] [ENSMUST00000228877]

Predicted Effect

probably damaging
Transcript: ENSMUST00000076236
AA Change: N662S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000075587
Gene: ENSMUSG00000022211
AA Change: N662S

Domain	Start	End	E-Value	Type
low complexity region	138	151	N/A	INTRINSIC
internal_repeat_1	203	297	7.56e-6	PROSPERO
Blast:LRR	333	362	5e-10	BLAST
Blast:LRR	423	446	1e-5	BLAST
low complexity region	447	462	N/A	INTRINSIC
low complexity region	468	479	N/A	INTRINSIC
internal_repeat_1	496	593	7.56e-6	PROSPERO
Pfam:CARMIL_C	778	1065	5.3e-76	PFAM
low complexity region	1068	1117	N/A	INTRINSIC
low complexity region	1137	1146	N/A	INTRINSIC
low complexity region	1204	1216	N/A	INTRINSIC
low complexity region	1318	1329	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000226446

Predicted Effect

probably benign
Transcript: ENSMUST00000226757

Predicted Effect

probably benign
Transcript: ENSMUST00000228877

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6b	A	G	12: 113,490,910	D449G	possibly damaging	Het
Ampd1	T	C	3: 103,080,989	S83P	probably benign	Het
Bub1	G	A	2: 127,807,830	L703F	probably benign	Het
C1rb	T	A	6: 124,574,658	D242E	probably damaging	Het
Carf	T	A	1: 60,150,593	L659Q	possibly damaging	Het
Ccno	A	G	13: 112,988,144	S83G	possibly damaging	Het
Chd3	A	T	11: 69,354,426	Y1155*	probably null	Het
Clec16a	A	G	16: 10,576,663	E295G	probably benign	Het
Clnk	A	G	5: 38,794,910		probably null	Het
Clvs2	T	C	10: 33,622,859	D25G	possibly damaging	Het
Cnr2	C	T	4: 135,917,516	R302W	probably damaging	Het
Dclk3	C	T	9: 111,468,719	R444W	possibly damaging	Het
Dmxl1	T	C	18: 49,865,116	V761A	probably damaging	Het
Dnah7a	C	A	1: 53,472,904	K2999N	possibly damaging	Het
Dusp28	T	C	1: 92,907,184	S44P	probably damaging	Het
Enpep	T	G	3: 129,309,125	N394T	probably damaging	Het
Fam135a	A	T	1: 24,021,917	F1343I	probably damaging	Het
Fbxl12	C	A	9: 20,638,864	R165L	possibly damaging	Het
Fbxo40	A	T	16: 36,970,585	H54Q	probably damaging	Het
Galnt9	A	G	5: 110,596,245	D315G	probably benign	Het
Gbp4	T	A	5: 105,119,934	D482V	probably damaging	Het
Gm17175	T	A	14: 51,571,613	I99F	possibly damaging	Het
Gm340	T	C	19: 41,585,449	I881T	possibly damaging	Het
Heatr4	A	G	12: 83,980,330	F51S	probably benign	Het
Herc1	T	C	9: 66,508,160	S4806P	probably damaging	Het
Hoxc11	G	A	15: 102,954,742	V73I	possibly damaging	Het
Knl1	T	G	2: 119,070,032	I738S	probably damaging	Het
Lipt2	T	C	7: 100,160,243	F179S	probably damaging	Het
Lrrc8b	G	A	5: 105,480,756	V323M	probably damaging	Het
Ltbp1	T	C	17: 75,292,857	S665P	probably benign	Het
Miga1	A	T	3: 152,322,408	D161E	probably benign	Het
Mynn	A	G	3: 30,603,784	T84A	probably benign	Het
Olfr1248	A	T	2: 89,617,987	D68E	probably damaging	Het
Olfr159	T	C	4: 43,770,598	S138G	possibly damaging	Het
Olfr401	T	C	11: 74,121,666	F126L	probably benign	Het
Pik3r3	C	T	4: 116,222,375	S23L	probably benign	Het
Plat	G	T	8: 22,772,232	G91W	probably damaging	Het
Plscr4	C	T	9: 92,490,790	R322*	probably null	Het
Ralgapa1	A	G	12: 55,659,062	S1892P	probably damaging	Het
Slc6a18	T	A	13: 73,665,574	Q540L	probably benign	Het
Tfap2a	A	T	13: 40,719,230	N323K	possibly damaging	Het
Tgm1	A	T	14: 55,705,643	M580K	probably benign	Het
Tnrc6b	G	A	15: 80,929,418	G1792D	unknown	Het
Trim66	T	A	7: 109,475,392	Q554L	possibly damaging	Het
Ttc28	G	A	5: 111,233,341	D1240N	probably benign	Het
Vmn1r238	G	T	18: 3,123,365	C16*	probably null	Het
Vmn1r6	G	A	6: 57,002,510	M52I	probably benign	Het
Zfp61	A	G	7: 24,292,034	F231L	probably benign	Het

Other mutations in Carmil3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Carmil3	APN	14	55498298	missense	probably damaging	0.99
IGL00498:Carmil3	APN	14	55501895	critical splice donor site	probably null
IGL01061:Carmil3	APN	14	55498630	missense	possibly damaging	0.67
IGL01452:Carmil3	APN	14	55496058	missense	probably damaging	0.99
IGL01606:Carmil3	APN	14	55493849	missense	possibly damaging	0.83
IGL01633:Carmil3	APN	14	55494227	missense	possibly damaging	0.84
IGL01977:Carmil3	APN	14	55493536	missense	probably damaging	1.00
IGL02065:Carmil3	APN	14	55493822	splice site	probably benign
IGL02160:Carmil3	APN	14	55493558	missense	possibly damaging	0.70
IGL02491:Carmil3	APN	14	55504517	missense	probably benign	0.00
IGL02567:Carmil3	APN	14	55498882	missense	possibly damaging	0.93
IGL02629:Carmil3	APN	14	55499068	missense	probably damaging	0.97
IGL02720:Carmil3	APN	14	55507410	missense	probably damaging	0.97
IGL03100:Carmil3	APN	14	55494718	missense	probably damaging	0.99
PIT4434001:Carmil3	UTSW	14	55494688	missense	probably null	1.00
R0023:Carmil3	UTSW	14	55492876	missense	probably damaging	1.00
R0023:Carmil3	UTSW	14	55492876	missense	probably damaging	1.00
R0027:Carmil3	UTSW	14	55494403	missense	probably damaging	0.96
R0101:Carmil3	UTSW	14	55497755	splice site	probably benign
R0321:Carmil3	UTSW	14	55502241	missense	possibly damaging	0.63
R0370:Carmil3	UTSW	14	55495442	missense	possibly damaging	0.82
R0465:Carmil3	UTSW	14	55499861	missense	probably damaging	0.99
R0647:Carmil3	UTSW	14	55502435	critical splice donor site	probably null
R1503:Carmil3	UTSW	14	55498280	missense	probably damaging	0.96
R1635:Carmil3	UTSW	14	55496282	missense	possibly damaging	0.91
R1715:Carmil3	UTSW	14	55504532	missense	probably benign	0.02
R1923:Carmil3	UTSW	14	55502404	missense	probably damaging	0.99
R1944:Carmil3	UTSW	14	55498630	missense	probably damaging	0.97
R2513:Carmil3	UTSW	14	55503838	missense	probably damaging	0.98
R2892:Carmil3	UTSW	14	55498313	missense	probably damaging	0.96
R3433:Carmil3	UTSW	14	55507694	missense	probably benign	0.05
R3552:Carmil3	UTSW	14	55507402	missense	possibly damaging	0.86
R3783:Carmil3	UTSW	14	55496976	missense	probably damaging	1.00
R3787:Carmil3	UTSW	14	55496976	missense	probably damaging	1.00
R4181:Carmil3	UTSW	14	55503955	missense	probably benign	0.10
R4285:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4420:Carmil3	UTSW	14	55493588	missense	probably damaging	0.98
R4424:Carmil3	UTSW	14	55501471	missense	probably benign
R4506:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4507:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4534:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4535:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4549:Carmil3	UTSW	14	55505664	splice site	probably null
R4574:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4783:Carmil3	UTSW	14	55501321	critical splice donor site	probably null
R4784:Carmil3	UTSW	14	55501321	critical splice donor site	probably null
R5146:Carmil3	UTSW	14	55497179	missense	probably benign	0.02
R5279:Carmil3	UTSW	14	55501571	missense	probably damaging	0.98
R5425:Carmil3	UTSW	14	55493877	missense	probably benign	0.41
R5530:Carmil3	UTSW	14	55493624	missense	probably damaging	0.98
R5534:Carmil3	UTSW	14	55494890	missense	probably damaging	0.97
R5598:Carmil3	UTSW	14	55503999	frame shift	probably null
R5772:Carmil3	UTSW	14	55493239	missense	probably damaging	1.00
R5896:Carmil3	UTSW	14	55503999	frame shift	probably null
R5931:Carmil3	UTSW	14	55498940	missense	probably damaging	0.99
R6048:Carmil3	UTSW	14	55503845	missense	probably benign	0.00
R6103:Carmil3	UTSW	14	55505427	missense	probably benign	0.02
R6258:Carmil3	UTSW	14	55500432	missense	probably damaging	1.00
R6260:Carmil3	UTSW	14	55500432	missense	probably damaging	1.00
R6338:Carmil3	UTSW	14	55499849	missense	possibly damaging	0.83
R6339:Carmil3	UTSW	14	55499849	missense	possibly damaging	0.83
R6646:Carmil3	UTSW	14	55507930	missense	probably damaging	0.97
R6936:Carmil3	UTSW	14	55501561	missense	probably benign	0.04
R7164:Carmil3	UTSW	14	55501282	missense	probably damaging	0.98
R7214:Carmil3	UTSW	14	55498612	missense	probably damaging	1.00
R7223:Carmil3	UTSW	14	55496238	missense	possibly damaging	0.48
R7269:Carmil3	UTSW	14	55493895	missense	probably benign	0.03
R7319:Carmil3	UTSW	14	55494360	missense	probably benign	0.13
R7357:Carmil3	UTSW	14	55491133	start gained	probably benign
R7386:Carmil3	UTSW	14	55497747	critical splice donor site	probably null
R7463:Carmil3	UTSW	14	55502396	missense	probably damaging	1.00
R7598:Carmil3	UTSW	14	55494821	missense	possibly damaging	0.61
R7602:Carmil3	UTSW	14	55501508	missense	probably null	0.00
R7617:Carmil3	UTSW	14	55497891	missense	probably benign	0.06
R7985:Carmil3	UTSW	14	55496952	missense	probably benign	0.03
R8127:Carmil3	UTSW	14	55498244	missense	probably damaging	0.98
R8465:Carmil3	UTSW	14	55496848	missense	probably damaging	1.00
U24488:Carmil3	UTSW	14	55497179	missense	probably benign	0.02
Z1088:Carmil3	UTSW	14	55501568	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTCATAGCAACCATACACTGCG -3'
(R):5'- CTTTTCTCAGGTCCAGTCTGGG -3'

Sequencing Primer
(F):5'- TGTGAGCGACATCTCTCAAG -3'
(R):5'- GGCACCATGCGATGCCTATG -3'

Posted On

2020-10-20