Incidental Mutation 'R8423:Vmn1r238'
ID653329
Institutional Source Beutler Lab
Gene Symbol Vmn1r238
Ensembl Gene ENSMUSG00000091539
Gene Namevomeronasal 1 receptor, 238
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R8423 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location3122492-3123412 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 3123365 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 16 (C16*)
Ref Sequence ENSEMBL: ENSMUSP00000129804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165255]
Predicted Effect probably null
Transcript: ENSMUST00000165255
AA Change: C16*
SMART Domains Protein: ENSMUSP00000129804
Gene: ENSMUSG00000091539
AA Change: C16*

DomainStartEndE-ValueType
Pfam:TAS2R 7 302 5.3e-8 PFAM
Pfam:7tm_1 27 292 8.8e-7 PFAM
Pfam:V1R 34 298 1.9e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A G 12: 113,490,910 D449G possibly damaging Het
Ampd1 T C 3: 103,080,989 S83P probably benign Het
Bub1 G A 2: 127,807,830 L703F probably benign Het
C1rb T A 6: 124,574,658 D242E probably damaging Het
Carf T A 1: 60,150,593 L659Q possibly damaging Het
Carmil3 A G 14: 55,499,065 N662S probably damaging Het
Ccno A G 13: 112,988,144 S83G possibly damaging Het
Chd3 A T 11: 69,354,426 Y1155* probably null Het
Clec16a A G 16: 10,576,663 E295G probably benign Het
Clnk A G 5: 38,794,910 probably null Het
Clvs2 T C 10: 33,622,859 D25G possibly damaging Het
Cnr2 C T 4: 135,917,516 R302W probably damaging Het
Dclk3 C T 9: 111,468,719 R444W possibly damaging Het
Dmxl1 T C 18: 49,865,116 V761A probably damaging Het
Dnah7a C A 1: 53,472,904 K2999N possibly damaging Het
Dusp28 T C 1: 92,907,184 S44P probably damaging Het
Enpep T G 3: 129,309,125 N394T probably damaging Het
Fam135a A T 1: 24,021,917 F1343I probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fbxo40 A T 16: 36,970,585 H54Q probably damaging Het
Galnt9 A G 5: 110,596,245 D315G probably benign Het
Gbp4 T A 5: 105,119,934 D482V probably damaging Het
Gm17175 T A 14: 51,571,613 I99F possibly damaging Het
Gm340 T C 19: 41,585,449 I881T possibly damaging Het
Heatr4 A G 12: 83,980,330 F51S probably benign Het
Herc1 T C 9: 66,508,160 S4806P probably damaging Het
Hoxc11 G A 15: 102,954,742 V73I possibly damaging Het
Knl1 T G 2: 119,070,032 I738S probably damaging Het
Lipt2 T C 7: 100,160,243 F179S probably damaging Het
Lrrc8b G A 5: 105,480,756 V323M probably damaging Het
Ltbp1 T C 17: 75,292,857 S665P probably benign Het
Miga1 A T 3: 152,322,408 D161E probably benign Het
Mynn A G 3: 30,603,784 T84A probably benign Het
Olfr1248 A T 2: 89,617,987 D68E probably damaging Het
Olfr159 T C 4: 43,770,598 S138G possibly damaging Het
Olfr401 T C 11: 74,121,666 F126L probably benign Het
Pik3r3 C T 4: 116,222,375 S23L probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ralgapa1 A G 12: 55,659,062 S1892P probably damaging Het
Slc6a18 T A 13: 73,665,574 Q540L probably benign Het
Tfap2a A T 13: 40,719,230 N323K possibly damaging Het
Tgm1 A T 14: 55,705,643 M580K probably benign Het
Tnrc6b G A 15: 80,929,418 G1792D unknown Het
Trim66 T A 7: 109,475,392 Q554L possibly damaging Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn1r6 G A 6: 57,002,510 M52I probably benign Het
Zfp61 A G 7: 24,292,034 F231L probably benign Het
Other mutations in Vmn1r238
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Vmn1r238 APN 18 3123243 missense probably benign 0.01
IGL01385:Vmn1r238 APN 18 3122770 missense possibly damaging 0.83
IGL02716:Vmn1r238 APN 18 3123124 missense probably damaging 1.00
R1219:Vmn1r238 UTSW 18 3123135 missense possibly damaging 0.81
R1568:Vmn1r238 UTSW 18 3123358 missense probably benign 0.00
R1864:Vmn1r238 UTSW 18 3123040 nonsense probably null
R3024:Vmn1r238 UTSW 18 3123305 missense probably benign 0.13
R4291:Vmn1r238 UTSW 18 3123214 nonsense probably null
R4304:Vmn1r238 UTSW 18 3123040 nonsense probably null
R4586:Vmn1r238 UTSW 18 3123294 missense probably damaging 1.00
R4664:Vmn1r238 UTSW 18 3123300 missense probably damaging 0.99
R5123:Vmn1r238 UTSW 18 3123243 missense probably benign
R5430:Vmn1r238 UTSW 18 3122521 missense possibly damaging 0.63
R5834:Vmn1r238 UTSW 18 3123168 missense probably benign
R7186:Vmn1r238 UTSW 18 3122661 missense probably damaging 0.99
R7206:Vmn1r238 UTSW 18 3122623 missense possibly damaging 0.94
R7308:Vmn1r238 UTSW 18 3122875 missense probably benign 0.09
R7346:Vmn1r238 UTSW 18 3123151 missense probably damaging 1.00
R7467:Vmn1r238 UTSW 18 3123393 missense probably benign 0.10
R7571:Vmn1r238 UTSW 18 3122721 missense probably damaging 1.00
R7808:Vmn1r238 UTSW 18 3123033 missense probably benign 0.03
R8085:Vmn1r238 UTSW 18 3123151 missense probably damaging 1.00
R8086:Vmn1r238 UTSW 18 3123250 missense probably damaging 1.00
R8325:Vmn1r238 UTSW 18 3122529 missense probably benign 0.00
Z1177:Vmn1r238 UTSW 18 3122505 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCAAAATATGACATTGTCTGTGG -3'
(R):5'- TAAAGATGCCTACCACCGCG -3'

Sequencing Primer
(F):5'- TGACATTGTCTGTGGAAACCC -3'
(R):5'- CACCTTTTTGCAGTGAGAGAAC -3'
Posted On2020-10-20