Incidental Mutation 'R8424:Cdk5rap1'
ID 653337
Institutional Source Beutler Lab
Gene Symbol Cdk5rap1
Ensembl Gene ENSMUSG00000027487
Gene Name CDK5 regulatory subunit associated protein 1
Synonyms 2310066P17Rik
MMRRC Submission 067818-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.348) question?
Stock # R8424 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 154177300-154214930 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 154187932 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 465 (T465A)
Ref Sequence ENSEMBL: ENSMUSP00000028990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028990] [ENSMUST00000109731]
AlphaFold Q8BTW8
Predicted Effect probably damaging
Transcript: ENSMUST00000028990
AA Change: T465A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028990
Gene: ENSMUSG00000027487
AA Change: T465A

DomainStartEndE-ValueType
Pfam:UPF0004 100 203 3.2e-31 PFAM
Elp3 247 486 4.83e-52 SMART
Pfam:TRAM 500 574 1.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109731
AA Change: T465A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105353
Gene: ENSMUSG00000027487
AA Change: T465A

DomainStartEndE-ValueType
Pfam:UPF0004 100 203 1.1e-31 PFAM
Elp3 247 486 4.83e-52 SMART
Pfam:TRAM 500 574 1e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of cyclin-dependent kinase 5 activity. This protein has also been reported to modify RNA by adding a methylthio-group and may thus have a dual function as an RNA methylthiotransferase and as an inhibitor of cyclin-dependent kinase 5 activity. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele show deficient mitochondrial tRNA modification, reduced mitochondrial protein synthesis, defects in oxidative phosphorylation, high susceptibility to stress-induced mitochondrial remodeling, and accelerated myopathy and cardiac dysfunction under stressed conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 78,946,885 (GRCm39) P42S probably damaging Het
Acss2 A G 2: 155,416,538 (GRCm39) T694A unknown Het
Adar C T 3: 89,643,301 (GRCm39) P394L probably damaging Het
Alx4 A G 2: 93,507,814 (GRCm39) M370V probably benign Het
Bag6 T A 17: 35,365,830 (GRCm39) L1089Q probably damaging Het
Bms1 T C 6: 118,365,721 (GRCm39) Y1155C probably benign Het
Cbl G A 9: 44,064,151 (GRCm39) T795I possibly damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 114,903,257 (GRCm39) probably benign Het
Cdc5l C A 17: 45,726,526 (GRCm39) A349S probably benign Het
Cdh5 G A 8: 104,856,003 (GRCm39) R312H probably benign Het
Cep135 C T 5: 76,741,906 (GRCm39) T114I possibly damaging Het
Csrp1 T C 1: 135,667,188 (GRCm39) V17A probably damaging Het
Cutal T C 2: 34,777,804 (GRCm39) S105P probably benign Het
Dgki C A 6: 36,827,850 (GRCm39) V1016L probably benign Het
Dnmt1 T C 9: 20,829,836 (GRCm39) N746S probably benign Het
Ep400 A T 5: 110,841,144 (GRCm39) V1796E unknown Het
Fam83a T A 15: 57,873,046 (GRCm39) S292T possibly damaging Het
H2ac4 A G 13: 23,935,267 (GRCm39) Y51C probably damaging Het
Keap1 C A 9: 21,142,086 (GRCm39) R596L probably benign Het
Klhl5 A C 5: 65,320,305 (GRCm39) T620P probably benign Het
Lbhd1 T A 19: 8,861,341 (GRCm39) D16E possibly damaging Het
Nadk2 T C 15: 9,083,414 (GRCm39) V110A possibly damaging Het
Ncbp1 A T 4: 46,144,839 (GRCm39) H30L probably benign Het
Or5ac21 A T 16: 59,123,772 (GRCm39) L85F possibly damaging Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Pmp22 G T 11: 63,023,902 (GRCm39) probably benign Het
Rc3h1 C T 1: 160,793,342 (GRCm39) L1076F probably damaging Het
Ryr3 T C 2: 112,672,239 (GRCm39) I1431V possibly damaging Het
S100a7a T A 3: 90,562,868 (GRCm39) H18Q probably damaging Het
Scd2 G T 19: 44,289,743 (GRCm39) C246F probably benign Het
Serpina1c T C 12: 103,862,296 (GRCm39) T340A possibly damaging Het
Setd5 A G 6: 113,126,644 (GRCm39) E1227G probably benign Het
Sh3yl1 G A 12: 30,974,862 (GRCm39) R71H probably damaging Het
Spry2 A G 14: 106,130,836 (GRCm39) S117P probably damaging Het
Srcap T C 7: 127,141,560 (GRCm39) V1780A probably benign Het
Sting1 A C 18: 35,872,223 (GRCm39) I93S probably benign Het
Tas2r130 T G 6: 131,607,790 (GRCm39) T2P probably benign Het
Tiam2 T A 17: 3,566,316 (GRCm39) F1454I probably damaging Het
Tiam2 T C 17: 3,566,317 (GRCm39) F1454S probably damaging Het
Tnpo3 A G 6: 29,555,205 (GRCm39) S793P probably benign Het
Ttc28 G A 5: 111,381,207 (GRCm39) D1240N probably benign Het
Ubap2l A T 3: 89,928,338 (GRCm39) D535E probably damaging Het
Ube2h A G 6: 30,260,940 (GRCm39) S65P probably damaging Het
Vmn1r203 T C 13: 22,709,004 (GRCm39) S262P probably damaging Het
Wfdc8 A G 2: 164,445,078 (GRCm39) F179S probably benign Het
Wnk1 T C 6: 119,911,388 (GRCm39) T2153A unknown Het
Zfhx3 G T 8: 109,583,385 (GRCm39) G1084V probably damaging Het
Zfp273 A G 13: 67,970,471 (GRCm39) N40D probably benign Het
Zfp352 C T 4: 90,112,480 (GRCm39) P207S possibly damaging Het
Zfp952 T A 17: 33,222,191 (GRCm39) F223L probably benign Het
Other mutations in Cdk5rap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Cdk5rap1 APN 2 154,207,956 (GRCm39) missense probably damaging 1.00
IGL02162:Cdk5rap1 APN 2 154,177,489 (GRCm39) missense probably damaging 0.98
IGL02626:Cdk5rap1 APN 2 154,207,880 (GRCm39) critical splice donor site probably null
IGL03278:Cdk5rap1 APN 2 154,212,622 (GRCm39) missense probably benign 0.00
R1052:Cdk5rap1 UTSW 2 154,202,519 (GRCm39) missense possibly damaging 0.96
R1333:Cdk5rap1 UTSW 2 154,202,574 (GRCm39) missense probably damaging 0.97
R1552:Cdk5rap1 UTSW 2 154,212,615 (GRCm39) missense probably benign 0.00
R1553:Cdk5rap1 UTSW 2 154,194,171 (GRCm39) missense probably damaging 1.00
R2107:Cdk5rap1 UTSW 2 154,195,166 (GRCm39) missense probably benign 0.22
R3946:Cdk5rap1 UTSW 2 154,190,636 (GRCm39) missense probably damaging 1.00
R4126:Cdk5rap1 UTSW 2 154,210,815 (GRCm39) missense probably damaging 1.00
R4715:Cdk5rap1 UTSW 2 154,203,755 (GRCm39) makesense probably null
R4865:Cdk5rap1 UTSW 2 154,212,876 (GRCm39) critical splice acceptor site probably null
R4866:Cdk5rap1 UTSW 2 154,212,876 (GRCm39) critical splice acceptor site probably null
R4867:Cdk5rap1 UTSW 2 154,212,876 (GRCm39) critical splice acceptor site probably null
R4946:Cdk5rap1 UTSW 2 154,210,794 (GRCm39) missense possibly damaging 0.91
R5087:Cdk5rap1 UTSW 2 154,184,315 (GRCm39) missense probably damaging 1.00
R5319:Cdk5rap1 UTSW 2 154,177,489 (GRCm39) missense possibly damaging 0.62
R5383:Cdk5rap1 UTSW 2 154,192,755 (GRCm39) missense possibly damaging 0.78
R5582:Cdk5rap1 UTSW 2 154,187,894 (GRCm39) missense probably benign 0.01
R5780:Cdk5rap1 UTSW 2 154,187,788 (GRCm39) frame shift probably null
R6262:Cdk5rap1 UTSW 2 154,212,606 (GRCm39) missense probably benign 0.04
R6274:Cdk5rap1 UTSW 2 154,210,161 (GRCm39) missense probably damaging 0.99
R7263:Cdk5rap1 UTSW 2 154,202,652 (GRCm39) missense probably benign 0.12
R7388:Cdk5rap1 UTSW 2 154,202,595 (GRCm39) missense probably damaging 1.00
R7650:Cdk5rap1 UTSW 2 154,196,036 (GRCm39) missense probably benign 0.01
R8694:Cdk5rap1 UTSW 2 154,195,148 (GRCm39) nonsense probably null
R9295:Cdk5rap1 UTSW 2 154,194,186 (GRCm39) missense probably damaging 1.00
R9413:Cdk5rap1 UTSW 2 154,207,880 (GRCm39) critical splice donor site probably null
R9453:Cdk5rap1 UTSW 2 154,190,585 (GRCm39) missense probably damaging 1.00
R9466:Cdk5rap1 UTSW 2 154,192,756 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- AGTTTGCCAAGGTCATAAGACAC -3'
(R):5'- TCAGTTACCCTTTCTCGTGGAATG -3'

Sequencing Primer
(F):5'- TGTAAACCAGACTGGCCTTG -3'
(R):5'- GTTCCTAAAACCAGAGAAGTAAGTC -3'
Posted On 2020-10-20