Incidental Mutation 'R8424:Acss2'
ID653338
Institutional Source Beutler Lab
Gene Symbol Acss2
Ensembl Gene ENSMUSG00000027605
Gene Nameacyl-CoA synthetase short-chain family member 2
SynonymsAcas1, acetyl-CoA synthetase 1, Acas2, AceCS1, ACAS, Acs1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R8424 (G1)
Quality Score218.009
Status Not validated
Chromosome2
Chromosomal Location155517948-155585724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155574618 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 694 (T694A)
Ref Sequence ENSEMBL: ENSMUSP00000068776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065973] [ENSMUST00000079691] [ENSMUST00000126322] [ENSMUST00000130881] [ENSMUST00000155347]
Predicted Effect unknown
Transcript: ENSMUST00000065973
AA Change: T694A
SMART Domains Protein: ENSMUSP00000068776
Gene: ENSMUSG00000027605
AA Change: T694A

DomainStartEndE-ValueType
Pfam:AMP-binding 108 575 4.8e-98 PFAM
Pfam:AMP-binding_C 583 660 3.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079691
SMART Domains Protein: ENSMUSP00000078630
Gene: ENSMUSG00000027610

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 12 472 6.7e-131 PFAM
Pfam:GSH_synthase 204 302 2.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126322
SMART Domains Protein: ENSMUSP00000117266
Gene: ENSMUSG00000027610

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 1 197 1.2e-63 PFAM
Pfam:GSH_synthase 160 200 3.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130881
SMART Domains Protein: ENSMUSP00000135319
Gene: ENSMUSG00000027610

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 1 404 9.2e-130 PFAM
Pfam:GSH_synthase 133 233 9e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155347
SMART Domains Protein: ENSMUSP00000122662
Gene: ENSMUSG00000027610

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 5 179 1.8e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175993
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic enzyme that catalyzes the activation of acetate for use in lipid synthesis and energy generation. The protein acts as a monomer and produces acetyl-CoA from acetate in a reaction that requires ATP. Expression of this gene is regulated by sterol regulatory element-binding proteins, transcription factors that activate genes required for the synthesis of cholesterol and unsaturated fatty acids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 79,297,137 P42S probably damaging Het
Adar C T 3: 89,735,994 P394L probably damaging Het
Alx4 A G 2: 93,677,469 M370V probably benign Het
Bag6 T A 17: 35,146,854 L1089Q probably damaging Het
Bms1 T C 6: 118,388,760 Y1155C probably benign Het
Cbl G A 9: 44,152,854 T795I possibly damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdc5l C A 17: 45,415,600 A349S probably benign Het
Cdh5 G A 8: 104,129,371 R312H probably benign Het
Cdk5rap1 T C 2: 154,346,012 T465A probably damaging Het
Cep135 C T 5: 76,594,059 T114I possibly damaging Het
Csrp1 T C 1: 135,739,450 V17A probably damaging Het
Cutal T C 2: 34,887,792 S105P probably benign Het
Dgki C A 6: 36,850,915 V1016L probably benign Het
Dnmt1 T C 9: 20,918,540 N746S probably benign Het
Ep400 A T 5: 110,693,278 V1796E unknown Het
Fam83a T A 15: 58,009,650 S292T possibly damaging Het
Hist1h2ab A G 13: 23,751,284 Y51C probably damaging Het
Keap1 C A 9: 21,230,790 R596L probably benign Het
Klhl5 A C 5: 65,162,962 T620P probably benign Het
Lbhd1 T A 19: 8,883,977 D16E possibly damaging Het
Nadk2 T C 15: 9,083,334 V110A possibly damaging Het
Ncbp1 A T 4: 46,144,839 H30L probably benign Het
Olfr203 A T 16: 59,303,409 L85F possibly damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pmp22 G T 11: 63,133,076 probably benign Het
Rc3h1 C T 1: 160,965,772 L1076F probably damaging Het
Ryr3 T C 2: 112,841,894 I1431V possibly damaging Het
S100a7a T A 3: 90,655,561 H18Q probably damaging Het
Scd2 G T 19: 44,301,304 C246F probably benign Het
Serpina1c T C 12: 103,896,037 T340A possibly damaging Het
Setd5 A G 6: 113,149,683 E1227G probably benign Het
Sh3yl1 G A 12: 30,924,863 R71H probably damaging Het
Spry2 A G 14: 105,893,402 S117P probably damaging Het
Srcap T C 7: 127,542,388 V1780A probably benign Het
Tas2r130 T G 6: 131,630,827 T2P probably benign Het
Tiam2 T A 17: 3,516,041 F1454I probably damaging Het
Tiam2 T C 17: 3,516,042 F1454S probably damaging Het
Tmem173 A C 18: 35,739,170 I93S probably benign Het
Tnpo3 A G 6: 29,555,206 S793P probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Ubap2l A T 3: 90,021,031 D535E probably damaging Het
Ube2h A G 6: 30,260,941 S65P probably damaging Het
Vmn1r203 T C 13: 22,524,834 S262P probably damaging Het
Wfdc8 A G 2: 164,603,158 F179S probably benign Het
Wnk1 T C 6: 119,934,427 T2153A unknown Het
Zfhx3 G T 8: 108,856,753 G1084V probably damaging Het
Zfp273 A G 13: 67,822,352 N40D probably benign Het
Zfp352 C T 4: 90,224,243 P207S possibly damaging Het
Zfp952 T A 17: 33,003,217 F223L probably benign Het
Other mutations in Acss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Acss2 APN 2 155562037 missense possibly damaging 0.83
IGL02333:Acss2 APN 2 155555884 missense probably damaging 1.00
IGL03278:Acss2 APN 2 155562001 missense possibly damaging 0.64
IGL03392:Acss2 APN 2 155562011 missense probably damaging 1.00
BB009:Acss2 UTSW 2 155573180 missense unknown
BB019:Acss2 UTSW 2 155573180 missense unknown
R1159:Acss2 UTSW 2 155551218 missense probably benign
R1293:Acss2 UTSW 2 155551221 missense probably benign
R1639:Acss2 UTSW 2 155556908 missense probably benign 0.01
R1725:Acss2 UTSW 2 155556844 missense possibly damaging 0.56
R1834:Acss2 UTSW 2 155558630 missense probably damaging 1.00
R1835:Acss2 UTSW 2 155558630 missense probably damaging 1.00
R1836:Acss2 UTSW 2 155558630 missense probably damaging 1.00
R2361:Acss2 UTSW 2 155558669 missense probably damaging 0.98
R3899:Acss2 UTSW 2 155557237 splice site probably benign
R4008:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4009:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4010:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4011:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4031:Acss2 UTSW 2 155557210 missense probably damaging 1.00
R4117:Acss2 UTSW 2 155556393 missense probably damaging 1.00
R4515:Acss2 UTSW 2 155556363 missense probably benign 0.39
R4756:Acss2 UTSW 2 155561143 missense probably damaging 1.00
R4895:Acss2 UTSW 2 155550481 splice site probably benign
R5327:Acss2 UTSW 2 155573229 missense probably null
R5654:Acss2 UTSW 2 155574655 unclassified probably benign
R5717:Acss2 UTSW 2 155561153 missense probably damaging 1.00
R5743:Acss2 UTSW 2 155574616 unclassified probably benign
R5773:Acss2 UTSW 2 155574694 splice site probably null
R5825:Acss2 UTSW 2 155549178 splice site probably null
R5979:Acss2 UTSW 2 155522109 missense possibly damaging 0.75
R6525:Acss2 UTSW 2 155550417 missense probably benign
R6551:Acss2 UTSW 2 155551208 missense probably benign
R6785:Acss2 UTSW 2 155560685 missense probably damaging 1.00
R6976:Acss2 UTSW 2 155556009 splice site probably null
R7074:Acss2 UTSW 2 155522041 missense possibly damaging 0.94
R7372:Acss2 UTSW 2 155557180 missense probably damaging 0.99
R7448:Acss2 UTSW 2 155518266 missense probably damaging 1.00
R7528:Acss2 UTSW 2 155557146 missense probably damaging 1.00
R7541:Acss2 UTSW 2 155574690 critical splice donor site probably null
R7543:Acss2 UTSW 2 155549835 missense probably damaging 0.98
R7754:Acss2 UTSW 2 155561166 missense probably benign 0.00
R7846:Acss2 UTSW 2 155561033 missense probably damaging 1.00
R7932:Acss2 UTSW 2 155573180 missense unknown
R8011:Acss2 UTSW 2 155555957 missense possibly damaging 0.73
R8481:Acss2 UTSW 2 155556461 nonsense probably null
R8878:Acss2 UTSW 2 155556404 missense probably benign 0.20
Z1177:Acss2 UTSW 2 155517957 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGTGCCAGATTCCCTCTCTG -3'
(R):5'- TTCTTGGAGGTGAGCCAACC -3'

Sequencing Primer
(F):5'- GTGCCAGATTCCCTCTCTGCTATTAG -3'
(R):5'- CCTACCCATGAGCAGAGTGGTTC -3'
Posted On2020-10-20