Incidental Mutation 'R8424:Ncbp1'
ID 653343
Institutional Source Beutler Lab
Gene Symbol Ncbp1
Ensembl Gene ENSMUSG00000028330
Gene Name nuclear cap binding protein subunit 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8424 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 46138613-46172403 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 46144839 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 30 (H30L)
Ref Sequence ENSEMBL: ENSMUSP00000030014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030014]
AlphaFold Q3UYV9
PDB Structure Mouse importin alpha: mouse CBP80 cNLS complex [X-RAY DIFFRACTION]
Mouse importin alpha: mouse CBP80Y8D cNLS complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000030014
AA Change: H30L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030014
Gene: ENSMUSG00000028330
AA Change: H30L

DomainStartEndE-ValueType
MIF4G 28 240 1.33e-38 SMART
Pfam:MIF4G_like 309 471 1.4e-37 PFAM
Pfam:MIF4G_like_2 485 754 4e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear cap-binding protein complex (CBC), which binds to the monomethylated 5' cap of nascent pre-mRNA in the nucleoplasm. The encoded protein promotes high-affinity mRNA-cap binding and associates with the CTD of RNA polymerase II. The CBC promotes pre-mRNA splicing, 3'-end processing, RNA nuclear export, and nonsense-mediated mRNA decay. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 79,297,137 P42S probably damaging Het
Acss2 A G 2: 155,574,618 T694A unknown Het
Adar C T 3: 89,735,994 P394L probably damaging Het
Alx4 A G 2: 93,677,469 M370V probably benign Het
Bag6 T A 17: 35,146,854 L1089Q probably damaging Het
Bms1 T C 6: 118,388,760 Y1155C probably benign Het
Cbl G A 9: 44,152,854 T795I possibly damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdc5l C A 17: 45,415,600 A349S probably benign Het
Cdh5 G A 8: 104,129,371 R312H probably benign Het
Cdk5rap1 T C 2: 154,346,012 T465A probably damaging Het
Cep135 C T 5: 76,594,059 T114I possibly damaging Het
Csrp1 T C 1: 135,739,450 V17A probably damaging Het
Cutal T C 2: 34,887,792 S105P probably benign Het
Dgki C A 6: 36,850,915 V1016L probably benign Het
Dnmt1 T C 9: 20,918,540 N746S probably benign Het
Ep400 A T 5: 110,693,278 V1796E unknown Het
Fam83a T A 15: 58,009,650 S292T possibly damaging Het
Hist1h2ab A G 13: 23,751,284 Y51C probably damaging Het
Keap1 C A 9: 21,230,790 R596L probably benign Het
Klhl5 A C 5: 65,162,962 T620P probably benign Het
Lbhd1 T A 19: 8,883,977 D16E possibly damaging Het
Nadk2 T C 15: 9,083,334 V110A possibly damaging Het
Olfr203 A T 16: 59,303,409 L85F possibly damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pmp22 G T 11: 63,133,076 probably benign Het
Rc3h1 C T 1: 160,965,772 L1076F probably damaging Het
Ryr3 T C 2: 112,841,894 I1431V possibly damaging Het
S100a7a T A 3: 90,655,561 H18Q probably damaging Het
Scd2 G T 19: 44,301,304 C246F probably benign Het
Serpina1c T C 12: 103,896,037 T340A possibly damaging Het
Setd5 A G 6: 113,149,683 E1227G probably benign Het
Sh3yl1 G A 12: 30,924,863 R71H probably damaging Het
Spry2 A G 14: 105,893,402 S117P probably damaging Het
Srcap T C 7: 127,542,388 V1780A probably benign Het
Tas2r130 T G 6: 131,630,827 T2P probably benign Het
Tiam2 T A 17: 3,516,041 F1454I probably damaging Het
Tiam2 T C 17: 3,516,042 F1454S probably damaging Het
Tmem173 A C 18: 35,739,170 I93S probably benign Het
Tnpo3 A G 6: 29,555,206 S793P probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Ubap2l A T 3: 90,021,031 D535E probably damaging Het
Ube2h A G 6: 30,260,941 S65P probably damaging Het
Vmn1r203 T C 13: 22,524,834 S262P probably damaging Het
Wfdc8 A G 2: 164,603,158 F179S probably benign Het
Wnk1 T C 6: 119,934,427 T2153A unknown Het
Zfhx3 G T 8: 108,856,753 G1084V probably damaging Het
Zfp273 A G 13: 67,822,352 N40D probably benign Het
Zfp352 C T 4: 90,224,243 P207S possibly damaging Het
Zfp952 T A 17: 33,003,217 F223L probably benign Het
Other mutations in Ncbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Ncbp1 APN 4 46161307 missense probably damaging 1.00
IGL02085:Ncbp1 APN 4 46159699 missense probably damaging 0.96
IGL02230:Ncbp1 APN 4 46165272 missense probably benign 0.03
IGL02561:Ncbp1 APN 4 46159711 missense possibly damaging 0.80
IGL02574:Ncbp1 APN 4 46168449 critical splice acceptor site probably null
IGL03371:Ncbp1 APN 4 46171991 nonsense probably null
R0549:Ncbp1 UTSW 4 46168476 missense possibly damaging 0.69
R0594:Ncbp1 UTSW 4 46170551 missense probably benign 0.00
R0699:Ncbp1 UTSW 4 46147528 missense probably benign 0.17
R0725:Ncbp1 UTSW 4 46152056 missense probably benign 0.01
R0961:Ncbp1 UTSW 4 46165193 missense possibly damaging 0.69
R1330:Ncbp1 UTSW 4 46167354 missense probably benign 0.19
R1622:Ncbp1 UTSW 4 46171963 missense possibly damaging 0.60
R1756:Ncbp1 UTSW 4 46169131 nonsense probably null
R2417:Ncbp1 UTSW 4 46168530 missense probably benign 0.20
R4050:Ncbp1 UTSW 4 46147483 missense probably damaging 0.99
R4132:Ncbp1 UTSW 4 46169241 nonsense probably null
R4516:Ncbp1 UTSW 4 46157824 missense probably damaging 1.00
R4795:Ncbp1 UTSW 4 46152967 missense possibly damaging 0.83
R4796:Ncbp1 UTSW 4 46152967 missense possibly damaging 0.83
R4960:Ncbp1 UTSW 4 46165273 nonsense probably null
R5557:Ncbp1 UTSW 4 46165259 missense probably benign 0.01
R5626:Ncbp1 UTSW 4 46161290 missense probably damaging 1.00
R5682:Ncbp1 UTSW 4 46170474 unclassified probably benign
R5859:Ncbp1 UTSW 4 46163026 missense probably benign 0.00
R6377:Ncbp1 UTSW 4 46150703 missense probably damaging 1.00
R6440:Ncbp1 UTSW 4 46147516 missense probably damaging 1.00
R6793:Ncbp1 UTSW 4 46157827 missense probably damaging 0.99
R7078:Ncbp1 UTSW 4 46155756 missense probably benign 0.00
R7434:Ncbp1 UTSW 4 46149910 missense probably damaging 1.00
R7445:Ncbp1 UTSW 4 46149914 missense probably damaging 0.98
R7477:Ncbp1 UTSW 4 46157897 missense probably damaging 1.00
R7670:Ncbp1 UTSW 4 46170015 missense probably damaging 0.96
R8970:Ncbp1 UTSW 4 46170023 missense probably damaging 0.99
R9712:Ncbp1 UTSW 4 46144837 missense probably benign 0.03
X0013:Ncbp1 UTSW 4 46150702 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTGAGATAGAAGTTCTCCAGGTAC -3'
(R):5'- GAAGGAATCCCAGGAGTTCC -3'

Sequencing Primer
(F):5'- GAAGTTCTCCAGGTACCTAGCTTAG -3'
(R):5'- TCCCAGGAGTTCCAAAACACTTTC -3'
Posted On 2020-10-20