Incidental Mutation 'R8424:Zfp352'
ID 653344
Institutional Source Beutler Lab
Gene Symbol Zfp352
Ensembl Gene ENSMUSG00000070902
Gene Name zinc finger protein 352
Synonyms 2czf48
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8424 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 90218820-90225702 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 90224243 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 207 (P207S)
Ref Sequence ENSEMBL: ENSMUSP00000102746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080541] [ENSMUST00000107129]
AlphaFold A2AML7
Predicted Effect possibly damaging
Transcript: ENSMUST00000080541
AA Change: P207S

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079383
Gene: ENSMUSG00000070902
AA Change: P207S

DomainStartEndE-ValueType
ZnF_C2H2 459 483 3.34e-2 SMART
ZnF_C2H2 489 513 8.22e-2 SMART
ZnF_C2H2 519 542 1.76e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107129
AA Change: P207S

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102746
Gene: ENSMUSG00000070902
AA Change: P207S

DomainStartEndE-ValueType
ZnF_C2H2 459 483 3.34e-2 SMART
ZnF_C2H2 489 513 8.22e-2 SMART
ZnF_C2H2 519 542 1.76e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 79,297,137 P42S probably damaging Het
Acss2 A G 2: 155,574,618 T694A unknown Het
Adar C T 3: 89,735,994 P394L probably damaging Het
Alx4 A G 2: 93,677,469 M370V probably benign Het
Bag6 T A 17: 35,146,854 L1089Q probably damaging Het
Bms1 T C 6: 118,388,760 Y1155C probably benign Het
Cbl G A 9: 44,152,854 T795I possibly damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdc5l C A 17: 45,415,600 A349S probably benign Het
Cdh5 G A 8: 104,129,371 R312H probably benign Het
Cdk5rap1 T C 2: 154,346,012 T465A probably damaging Het
Cep135 C T 5: 76,594,059 T114I possibly damaging Het
Csrp1 T C 1: 135,739,450 V17A probably damaging Het
Cutal T C 2: 34,887,792 S105P probably benign Het
Dgki C A 6: 36,850,915 V1016L probably benign Het
Dnmt1 T C 9: 20,918,540 N746S probably benign Het
Ep400 A T 5: 110,693,278 V1796E unknown Het
Fam83a T A 15: 58,009,650 S292T possibly damaging Het
Hist1h2ab A G 13: 23,751,284 Y51C probably damaging Het
Keap1 C A 9: 21,230,790 R596L probably benign Het
Klhl5 A C 5: 65,162,962 T620P probably benign Het
Lbhd1 T A 19: 8,883,977 D16E possibly damaging Het
Nadk2 T C 15: 9,083,334 V110A possibly damaging Het
Ncbp1 A T 4: 46,144,839 H30L probably benign Het
Olfr203 A T 16: 59,303,409 L85F possibly damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pmp22 G T 11: 63,133,076 probably benign Het
Rc3h1 C T 1: 160,965,772 L1076F probably damaging Het
Ryr3 T C 2: 112,841,894 I1431V possibly damaging Het
S100a7a T A 3: 90,655,561 H18Q probably damaging Het
Scd2 G T 19: 44,301,304 C246F probably benign Het
Serpina1c T C 12: 103,896,037 T340A possibly damaging Het
Setd5 A G 6: 113,149,683 E1227G probably benign Het
Sh3yl1 G A 12: 30,924,863 R71H probably damaging Het
Spry2 A G 14: 105,893,402 S117P probably damaging Het
Srcap T C 7: 127,542,388 V1780A probably benign Het
Tas2r130 T G 6: 131,630,827 T2P probably benign Het
Tiam2 T A 17: 3,516,041 F1454I probably damaging Het
Tiam2 T C 17: 3,516,042 F1454S probably damaging Het
Tmem173 A C 18: 35,739,170 I93S probably benign Het
Tnpo3 A G 6: 29,555,206 S793P probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Ubap2l A T 3: 90,021,031 D535E probably damaging Het
Ube2h A G 6: 30,260,941 S65P probably damaging Het
Vmn1r203 T C 13: 22,524,834 S262P probably damaging Het
Wfdc8 A G 2: 164,603,158 F179S probably benign Het
Wnk1 T C 6: 119,934,427 T2153A unknown Het
Zfhx3 G T 8: 108,856,753 G1084V probably damaging Het
Zfp273 A G 13: 67,822,352 N40D probably benign Het
Zfp952 T A 17: 33,003,217 F223L probably benign Het
Other mutations in Zfp352
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Zfp352 APN 4 90224154 missense possibly damaging 0.95
IGL02252:Zfp352 APN 4 90224130 missense probably benign 0.02
IGL03156:Zfp352 APN 4 90224087 missense possibly damaging 0.57
IGL03167:Zfp352 APN 4 90224702 missense probably damaging 0.99
IGL03190:Zfp352 APN 4 90223757 missense possibly damaging 0.94
IGL03335:Zfp352 APN 4 90224346 missense probably damaging 0.99
R0051:Zfp352 UTSW 4 90224285 missense probably damaging 0.99
R0403:Zfp352 UTSW 4 90225009 missense possibly damaging 0.60
R0550:Zfp352 UTSW 4 90224690 missense probably damaging 0.99
R0671:Zfp352 UTSW 4 90223919 missense probably benign
R1034:Zfp352 UTSW 4 90224156 missense possibly damaging 0.94
R1754:Zfp352 UTSW 4 90223809 missense probably benign 0.23
R2016:Zfp352 UTSW 4 90225171 missense probably benign 0.42
R2064:Zfp352 UTSW 4 90225120 missense probably benign 0.08
R2308:Zfp352 UTSW 4 90225243 missense probably benign 0.00
R3552:Zfp352 UTSW 4 90225102 missense probably benign 0.33
R3794:Zfp352 UTSW 4 90225149 missense probably damaging 1.00
R3795:Zfp352 UTSW 4 90225149 missense probably damaging 1.00
R4135:Zfp352 UTSW 4 90225024 missense probably damaging 0.96
R4356:Zfp352 UTSW 4 90223834 missense possibly damaging 0.91
R4409:Zfp352 UTSW 4 90225164 missense probably benign 0.00
R4590:Zfp352 UTSW 4 90224535 missense probably damaging 0.98
R4614:Zfp352 UTSW 4 90225081 missense probably benign 0.00
R4617:Zfp352 UTSW 4 90225081 missense probably benign 0.00
R4618:Zfp352 UTSW 4 90225081 missense probably benign 0.00
R4741:Zfp352 UTSW 4 90224940 missense possibly damaging 0.94
R4931:Zfp352 UTSW 4 90224304 missense probably damaging 0.98
R4959:Zfp352 UTSW 4 90224139 missense probably benign 0.01
R4973:Zfp352 UTSW 4 90224139 missense probably benign 0.01
R5167:Zfp352 UTSW 4 90224216 missense possibly damaging 0.94
R5260:Zfp352 UTSW 4 90224460 missense probably damaging 0.99
R5524:Zfp352 UTSW 4 90225104 missense possibly damaging 0.95
R5942:Zfp352 UTSW 4 90225070 missense probably damaging 0.98
R6802:Zfp352 UTSW 4 90225200 missense probably benign 0.33
R6819:Zfp352 UTSW 4 90224699 missense probably benign
R7072:Zfp352 UTSW 4 90224424 missense probably benign 0.00
R7099:Zfp352 UTSW 4 90224880 missense probably benign 0.00
R7569:Zfp352 UTSW 4 90223659 missense possibly damaging 0.77
R7645:Zfp352 UTSW 4 90224777 missense probably benign 0.13
R7705:Zfp352 UTSW 4 90225275 missense possibly damaging 0.94
R9180:Zfp352 UTSW 4 90224881 missense probably benign 0.38
R9378:Zfp352 UTSW 4 90224338 missense probably benign 0.13
R9509:Zfp352 UTSW 4 90224706 missense probably damaging 0.99
R9623:Zfp352 UTSW 4 90224891 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGCCATGTGTGAGAATCAG -3'
(R):5'- TGACCACTGAAGGATTTCATTTGG -3'

Sequencing Primer
(F):5'- CATGTGTGAGAATCAGAGGGTTACC -3'
(R):5'- GTTTGGTCAAAGTTAGCTCTCATC -3'
Posted On 2020-10-20