Incidental Mutation 'R8424:Ep400'
ID 653347
Institutional Source Beutler Lab
Gene Symbol Ep400
Ensembl Gene ENSMUSG00000029505
Gene Name E1A binding protein p400
Synonyms 1700020J09Rik, p400, mDomino
MMRRC Submission 067818-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8424 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 110812239-110918583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 110841144 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 1796 (V1796E)
Ref Sequence ENSEMBL: ENSMUSP00000049038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041558] [ENSMUST00000112435] [ENSMUST00000112436]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000041558
AA Change: V1796E
SMART Domains Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505
AA Change: V1796E

DomainStartEndE-ValueType
Pfam:EP400_N 1 461 1.6e-232 PFAM
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
HSA 762 833 1.31e-31 SMART
low complexity region 908 925 N/A INTRINSIC
DEXDc 1049 1238 2.76e-15 SMART
Blast:DEXDc 1276 1317 2e-15 BLAST
low complexity region 1407 1417 N/A INTRINSIC
HELICc 1807 1893 1.17e-4 SMART
low complexity region 2006 2019 N/A INTRINSIC
low complexity region 2080 2100 N/A INTRINSIC
low complexity region 2214 2223 N/A INTRINSIC
SANT 2243 2310 3.57e-1 SMART
low complexity region 2402 2489 N/A INTRINSIC
low complexity region 2596 2608 N/A INTRINSIC
low complexity region 2644 2679 N/A INTRINSIC
low complexity region 2694 2738 N/A INTRINSIC
low complexity region 2769 2806 N/A INTRINSIC
low complexity region 2846 2883 N/A INTRINSIC
low complexity region 2933 2947 N/A INTRINSIC
low complexity region 2974 2986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112435
SMART Domains Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 668 682 N/A INTRINSIC
low complexity region 695 723 N/A INTRINSIC
HSA 799 870 1.31e-31 SMART
low complexity region 945 962 N/A INTRINSIC
DEXDc 1086 1275 2.76e-15 SMART
Blast:DEXDc 1313 1354 2e-15 BLAST
low complexity region 1444 1454 N/A INTRINSIC
internal_repeat_1 1556 1646 6.82e-5 PROSPERO
low complexity region 1887 1900 N/A INTRINSIC
low complexity region 1961 1981 N/A INTRINSIC
low complexity region 2095 2104 N/A INTRINSIC
SANT 2124 2191 3.57e-1 SMART
low complexity region 2283 2370 N/A INTRINSIC
internal_repeat_1 2371 2463 6.82e-5 PROSPERO
low complexity region 2477 2489 N/A INTRINSIC
low complexity region 2525 2560 N/A INTRINSIC
low complexity region 2575 2619 N/A INTRINSIC
low complexity region 2645 2659 N/A INTRINSIC
low complexity region 2660 2680 N/A INTRINSIC
low complexity region 2720 2757 N/A INTRINSIC
low complexity region 2807 2821 N/A INTRINSIC
low complexity region 2848 2860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112436
AA Change: V1760E
SMART Domains Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505
AA Change: V1760E

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 472 482 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
HSA 726 797 1.31e-31 SMART
low complexity region 872 889 N/A INTRINSIC
DEXDc 1013 1202 2.76e-15 SMART
Blast:DEXDc 1240 1281 2e-15 BLAST
low complexity region 1371 1381 N/A INTRINSIC
internal_repeat_1 1483 1573 6.76e-5 PROSPERO
HELICc 1771 1857 1.17e-4 SMART
low complexity region 1970 1983 N/A INTRINSIC
low complexity region 2044 2064 N/A INTRINSIC
low complexity region 2178 2187 N/A INTRINSIC
SANT 2207 2274 3.57e-1 SMART
low complexity region 2366 2453 N/A INTRINSIC
internal_repeat_1 2454 2546 6.76e-5 PROSPERO
low complexity region 2560 2572 N/A INTRINSIC
low complexity region 2608 2643 N/A INTRINSIC
low complexity region 2658 2702 N/A INTRINSIC
low complexity region 2733 2770 N/A INTRINSIC
low complexity region 2810 2847 N/A INTRINSIC
low complexity region 2897 2911 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125325
SMART Domains Protein: ENSMUSP00000116137
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
low complexity region 107 117 N/A INTRINSIC
low complexity region 223 239 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die at E11.5 and display severe defects in yolk sac erythropoiesis, anemia, and a slight deformity of the neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 78,946,885 (GRCm39) P42S probably damaging Het
Acss2 A G 2: 155,416,538 (GRCm39) T694A unknown Het
Adar C T 3: 89,643,301 (GRCm39) P394L probably damaging Het
Alx4 A G 2: 93,507,814 (GRCm39) M370V probably benign Het
Bag6 T A 17: 35,365,830 (GRCm39) L1089Q probably damaging Het
Bms1 T C 6: 118,365,721 (GRCm39) Y1155C probably benign Het
Cbl G A 9: 44,064,151 (GRCm39) T795I possibly damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 114,903,257 (GRCm39) probably benign Het
Cdc5l C A 17: 45,726,526 (GRCm39) A349S probably benign Het
Cdh5 G A 8: 104,856,003 (GRCm39) R312H probably benign Het
Cdk5rap1 T C 2: 154,187,932 (GRCm39) T465A probably damaging Het
Cep135 C T 5: 76,741,906 (GRCm39) T114I possibly damaging Het
Csrp1 T C 1: 135,667,188 (GRCm39) V17A probably damaging Het
Cutal T C 2: 34,777,804 (GRCm39) S105P probably benign Het
Dgki C A 6: 36,827,850 (GRCm39) V1016L probably benign Het
Dnmt1 T C 9: 20,829,836 (GRCm39) N746S probably benign Het
Fam83a T A 15: 57,873,046 (GRCm39) S292T possibly damaging Het
H2ac4 A G 13: 23,935,267 (GRCm39) Y51C probably damaging Het
Keap1 C A 9: 21,142,086 (GRCm39) R596L probably benign Het
Klhl5 A C 5: 65,320,305 (GRCm39) T620P probably benign Het
Lbhd1 T A 19: 8,861,341 (GRCm39) D16E possibly damaging Het
Nadk2 T C 15: 9,083,414 (GRCm39) V110A possibly damaging Het
Ncbp1 A T 4: 46,144,839 (GRCm39) H30L probably benign Het
Or5ac21 A T 16: 59,123,772 (GRCm39) L85F possibly damaging Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Pmp22 G T 11: 63,023,902 (GRCm39) probably benign Het
Rc3h1 C T 1: 160,793,342 (GRCm39) L1076F probably damaging Het
Ryr3 T C 2: 112,672,239 (GRCm39) I1431V possibly damaging Het
S100a7a T A 3: 90,562,868 (GRCm39) H18Q probably damaging Het
Scd2 G T 19: 44,289,743 (GRCm39) C246F probably benign Het
Serpina1c T C 12: 103,862,296 (GRCm39) T340A possibly damaging Het
Setd5 A G 6: 113,126,644 (GRCm39) E1227G probably benign Het
Sh3yl1 G A 12: 30,974,862 (GRCm39) R71H probably damaging Het
Spry2 A G 14: 106,130,836 (GRCm39) S117P probably damaging Het
Srcap T C 7: 127,141,560 (GRCm39) V1780A probably benign Het
Sting1 A C 18: 35,872,223 (GRCm39) I93S probably benign Het
Tas2r130 T G 6: 131,607,790 (GRCm39) T2P probably benign Het
Tiam2 T A 17: 3,566,316 (GRCm39) F1454I probably damaging Het
Tiam2 T C 17: 3,566,317 (GRCm39) F1454S probably damaging Het
Tnpo3 A G 6: 29,555,205 (GRCm39) S793P probably benign Het
Ttc28 G A 5: 111,381,207 (GRCm39) D1240N probably benign Het
Ubap2l A T 3: 89,928,338 (GRCm39) D535E probably damaging Het
Ube2h A G 6: 30,260,940 (GRCm39) S65P probably damaging Het
Vmn1r203 T C 13: 22,709,004 (GRCm39) S262P probably damaging Het
Wfdc8 A G 2: 164,445,078 (GRCm39) F179S probably benign Het
Wnk1 T C 6: 119,911,388 (GRCm39) T2153A unknown Het
Zfhx3 G T 8: 109,583,385 (GRCm39) G1084V probably damaging Het
Zfp273 A G 13: 67,970,471 (GRCm39) N40D probably benign Het
Zfp352 C T 4: 90,112,480 (GRCm39) P207S possibly damaging Het
Zfp952 T A 17: 33,222,191 (GRCm39) F223L probably benign Het
Other mutations in Ep400
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ep400 APN 5 110,835,707 (GRCm39) missense unknown
IGL00585:Ep400 APN 5 110,903,771 (GRCm39) missense possibly damaging 0.70
IGL00586:Ep400 APN 5 110,887,460 (GRCm39) missense probably damaging 1.00
IGL00816:Ep400 APN 5 110,883,356 (GRCm39) unclassified probably benign
IGL01066:Ep400 APN 5 110,816,065 (GRCm39) splice site probably benign
IGL01302:Ep400 APN 5 110,889,914 (GRCm39) missense probably benign 0.00
IGL01568:Ep400 APN 5 110,867,361 (GRCm39) missense unknown
IGL01833:Ep400 APN 5 110,827,874 (GRCm39) missense unknown
IGL02086:Ep400 APN 5 110,824,809 (GRCm39) splice site probably benign
IGL02266:Ep400 APN 5 110,843,163 (GRCm39) unclassified probably benign
IGL02288:Ep400 APN 5 110,831,702 (GRCm39) splice site probably benign
IGL02301:Ep400 APN 5 110,822,826 (GRCm39) missense probably damaging 1.00
IGL02377:Ep400 APN 5 110,868,691 (GRCm39) missense unknown
IGL02382:Ep400 APN 5 110,849,594 (GRCm39) missense unknown
IGL02419:Ep400 APN 5 110,845,242 (GRCm39) splice site probably null
IGL02591:Ep400 APN 5 110,881,638 (GRCm39) unclassified probably benign
IGL02981:Ep400 APN 5 110,839,476 (GRCm39) splice site probably benign
IGL02981:Ep400 APN 5 110,903,969 (GRCm39) missense possibly damaging 0.79
IGL03173:Ep400 APN 5 110,856,737 (GRCm39) unclassified probably benign
IGL03244:Ep400 APN 5 110,875,429 (GRCm39) missense unknown
IGL03333:Ep400 APN 5 110,851,432 (GRCm39) missense unknown
santol UTSW 5 110,849,537 (GRCm39) missense unknown
PIT4243001:Ep400 UTSW 5 110,883,446 (GRCm39) missense unknown
PIT4260001:Ep400 UTSW 5 110,841,037 (GRCm39) nonsense probably null
R0017:Ep400 UTSW 5 110,821,395 (GRCm39) missense probably damaging 1.00
R0179:Ep400 UTSW 5 110,816,515 (GRCm39) missense probably damaging 0.99
R0243:Ep400 UTSW 5 110,872,273 (GRCm39) splice site probably benign
R0366:Ep400 UTSW 5 110,849,537 (GRCm39) missense unknown
R0508:Ep400 UTSW 5 110,887,374 (GRCm39) missense probably benign 0.00
R0541:Ep400 UTSW 5 110,852,882 (GRCm39) missense unknown
R0558:Ep400 UTSW 5 110,832,933 (GRCm39) splice site probably benign
R0576:Ep400 UTSW 5 110,858,959 (GRCm39) unclassified probably benign
R0595:Ep400 UTSW 5 110,851,408 (GRCm39) missense unknown
R0671:Ep400 UTSW 5 110,836,062 (GRCm39) missense unknown
R0763:Ep400 UTSW 5 110,813,703 (GRCm39) missense probably damaging 1.00
R1078:Ep400 UTSW 5 110,883,388 (GRCm39) unclassified probably benign
R1300:Ep400 UTSW 5 110,821,426 (GRCm39) missense probably damaging 1.00
R1439:Ep400 UTSW 5 110,833,344 (GRCm39) missense unknown
R1520:Ep400 UTSW 5 110,839,644 (GRCm39) intron probably benign
R1529:Ep400 UTSW 5 110,887,311 (GRCm39) missense probably benign 0.00
R1535:Ep400 UTSW 5 110,856,032 (GRCm39) unclassified probably benign
R1560:Ep400 UTSW 5 110,818,972 (GRCm39) splice site probably null
R1587:Ep400 UTSW 5 110,874,768 (GRCm39) missense probably benign 0.23
R1596:Ep400 UTSW 5 110,856,727 (GRCm39) unclassified probably benign
R1653:Ep400 UTSW 5 110,841,040 (GRCm39) nonsense probably null
R1711:Ep400 UTSW 5 110,841,174 (GRCm39) unclassified probably benign
R1774:Ep400 UTSW 5 110,833,357 (GRCm39) missense unknown
R1836:Ep400 UTSW 5 110,852,920 (GRCm39) missense unknown
R1905:Ep400 UTSW 5 110,818,814 (GRCm39) missense probably damaging 1.00
R1917:Ep400 UTSW 5 110,851,441 (GRCm39) missense unknown
R2064:Ep400 UTSW 5 110,883,270 (GRCm39) unclassified probably benign
R2122:Ep400 UTSW 5 110,856,716 (GRCm39) unclassified probably benign
R2144:Ep400 UTSW 5 110,851,384 (GRCm39) missense unknown
R2215:Ep400 UTSW 5 110,841,421 (GRCm39) unclassified probably benign
R2252:Ep400 UTSW 5 110,866,957 (GRCm39) missense unknown
R2253:Ep400 UTSW 5 110,866,957 (GRCm39) missense unknown
R2483:Ep400 UTSW 5 110,867,102 (GRCm39) missense unknown
R2504:Ep400 UTSW 5 110,816,511 (GRCm39) missense probably damaging 1.00
R2512:Ep400 UTSW 5 110,856,781 (GRCm39) unclassified probably benign
R2842:Ep400 UTSW 5 110,846,681 (GRCm39) nonsense probably null
R2920:Ep400 UTSW 5 110,903,780 (GRCm39) missense probably damaging 1.00
R3082:Ep400 UTSW 5 110,841,096 (GRCm39) unclassified probably benign
R3151:Ep400 UTSW 5 110,851,435 (GRCm39) missense unknown
R3552:Ep400 UTSW 5 110,877,153 (GRCm39) missense unknown
R3623:Ep400 UTSW 5 110,867,102 (GRCm39) missense unknown
R3779:Ep400 UTSW 5 110,839,515 (GRCm39) missense unknown
R3923:Ep400 UTSW 5 110,904,389 (GRCm39) missense possibly damaging 0.55
R4062:Ep400 UTSW 5 110,889,847 (GRCm39) missense probably benign 0.10
R4508:Ep400 UTSW 5 110,851,481 (GRCm39) missense unknown
R4584:Ep400 UTSW 5 110,881,763 (GRCm39) unclassified probably benign
R4585:Ep400 UTSW 5 110,901,725 (GRCm39) missense probably damaging 1.00
R4586:Ep400 UTSW 5 110,901,725 (GRCm39) missense probably damaging 1.00
R4807:Ep400 UTSW 5 110,843,444 (GRCm39) splice site probably null
R4921:Ep400 UTSW 5 110,813,676 (GRCm39) missense probably damaging 1.00
R4976:Ep400 UTSW 5 110,868,622 (GRCm39) missense unknown
R4976:Ep400 UTSW 5 110,846,678 (GRCm39) missense unknown
R5075:Ep400 UTSW 5 110,833,351 (GRCm39) missense unknown
R5120:Ep400 UTSW 5 110,904,224 (GRCm39) missense probably damaging 1.00
R5122:Ep400 UTSW 5 110,816,036 (GRCm39) missense probably damaging 1.00
R5223:Ep400 UTSW 5 110,816,496 (GRCm39) missense probably damaging 1.00
R5284:Ep400 UTSW 5 110,815,990 (GRCm39) missense probably damaging 1.00
R5388:Ep400 UTSW 5 110,849,594 (GRCm39) missense unknown
R5401:Ep400 UTSW 5 110,831,037 (GRCm39) missense unknown
R5431:Ep400 UTSW 5 110,824,420 (GRCm39) missense unknown
R5461:Ep400 UTSW 5 110,824,550 (GRCm39) nonsense probably null
R5568:Ep400 UTSW 5 110,904,071 (GRCm39) missense probably damaging 1.00
R5650:Ep400 UTSW 5 110,843,818 (GRCm39) critical splice donor site probably null
R5778:Ep400 UTSW 5 110,867,450 (GRCm39) missense unknown
R5806:Ep400 UTSW 5 110,903,420 (GRCm39) nonsense probably null
R5814:Ep400 UTSW 5 110,843,444 (GRCm39) splice site probably null
R5830:Ep400 UTSW 5 110,831,862 (GRCm39) missense unknown
R5882:Ep400 UTSW 5 110,903,453 (GRCm39) missense probably benign 0.00
R5931:Ep400 UTSW 5 110,883,386 (GRCm39) unclassified probably benign
R5945:Ep400 UTSW 5 110,830,732 (GRCm39) missense unknown
R5966:Ep400 UTSW 5 110,824,766 (GRCm39) missense unknown
R5973:Ep400 UTSW 5 110,877,697 (GRCm39) missense unknown
R5980:Ep400 UTSW 5 110,881,595 (GRCm39) unclassified probably benign
R6000:Ep400 UTSW 5 110,831,067 (GRCm39) missense unknown
R6006:Ep400 UTSW 5 110,852,825 (GRCm39) missense unknown
R6053:Ep400 UTSW 5 110,903,661 (GRCm39) missense probably benign 0.22
R6145:Ep400 UTSW 5 110,904,569 (GRCm39) missense possibly damaging 0.95
R6154:Ep400 UTSW 5 110,903,799 (GRCm39) missense probably damaging 0.97
R6169:Ep400 UTSW 5 110,889,863 (GRCm39) missense possibly damaging 0.83
R6228:Ep400 UTSW 5 110,818,808 (GRCm39) missense probably damaging 1.00
R6295:Ep400 UTSW 5 110,901,675 (GRCm39) missense probably benign 0.00
R6486:Ep400 UTSW 5 110,845,084 (GRCm39) unclassified probably benign
R6504:Ep400 UTSW 5 110,856,703 (GRCm39) unclassified probably benign
R6607:Ep400 UTSW 5 110,831,180 (GRCm39) missense unknown
R6657:Ep400 UTSW 5 110,841,411 (GRCm39) unclassified probably benign
R6660:Ep400 UTSW 5 110,867,313 (GRCm39) nonsense probably null
R6741:Ep400 UTSW 5 110,824,761 (GRCm39) missense unknown
R6933:Ep400 UTSW 5 110,813,728 (GRCm39) missense probably damaging 1.00
R6937:Ep400 UTSW 5 110,859,018 (GRCm39) unclassified probably benign
R7069:Ep400 UTSW 5 110,815,990 (GRCm39) missense probably damaging 1.00
R7103:Ep400 UTSW 5 110,881,651 (GRCm39) missense unknown
R7156:Ep400 UTSW 5 110,833,229 (GRCm39) missense unknown
R7272:Ep400 UTSW 5 110,903,511 (GRCm39) nonsense probably null
R7365:Ep400 UTSW 5 110,867,480 (GRCm39) missense unknown
R7581:Ep400 UTSW 5 110,903,891 (GRCm39) missense unknown
R7684:Ep400 UTSW 5 110,845,218 (GRCm39) missense unknown
R7699:Ep400 UTSW 5 110,843,898 (GRCm39) missense unknown
R7700:Ep400 UTSW 5 110,843,898 (GRCm39) missense unknown
R7856:Ep400 UTSW 5 110,814,450 (GRCm39) missense probably damaging 0.99
R7954:Ep400 UTSW 5 110,816,599 (GRCm39) missense possibly damaging 0.46
R8098:Ep400 UTSW 5 110,841,117 (GRCm39) missense unknown
R8108:Ep400 UTSW 5 110,835,749 (GRCm39) missense unknown
R8260:Ep400 UTSW 5 110,903,478 (GRCm39) nonsense probably null
R8293:Ep400 UTSW 5 110,856,758 (GRCm39) missense unknown
R8314:Ep400 UTSW 5 110,903,619 (GRCm39) missense unknown
R8351:Ep400 UTSW 5 110,887,200 (GRCm39) missense probably damaging 1.00
R8459:Ep400 UTSW 5 110,856,757 (GRCm39) missense unknown
R8529:Ep400 UTSW 5 110,867,102 (GRCm39) missense unknown
R8688:Ep400 UTSW 5 110,868,685 (GRCm39) missense unknown
R8744:Ep400 UTSW 5 110,889,925 (GRCm39) missense unknown
R8923:Ep400 UTSW 5 110,831,864 (GRCm39) missense unknown
R9005:Ep400 UTSW 5 110,858,959 (GRCm39) missense unknown
R9087:Ep400 UTSW 5 110,815,430 (GRCm39) nonsense probably null
R9146:Ep400 UTSW 5 110,849,635 (GRCm39) nonsense probably null
R9383:Ep400 UTSW 5 110,833,351 (GRCm39) missense unknown
R9479:Ep400 UTSW 5 110,877,730 (GRCm39) missense unknown
R9496:Ep400 UTSW 5 110,855,853 (GRCm39) missense unknown
R9582:Ep400 UTSW 5 110,824,315 (GRCm39) critical splice donor site probably null
R9607:Ep400 UTSW 5 110,831,805 (GRCm39) missense unknown
R9712:Ep400 UTSW 5 110,904,509 (GRCm39) missense unknown
R9746:Ep400 UTSW 5 110,889,872 (GRCm39) missense unknown
X0012:Ep400 UTSW 5 110,821,062 (GRCm39) small deletion probably benign
X0021:Ep400 UTSW 5 110,830,730 (GRCm39) missense unknown
Z1176:Ep400 UTSW 5 110,904,501 (GRCm39) missense unknown
Z1177:Ep400 UTSW 5 110,881,609 (GRCm39) missense unknown
Z1177:Ep400 UTSW 5 110,831,230 (GRCm39) missense unknown
Z1188:Ep400 UTSW 5 110,903,549 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGAGGCCTAAACCCAAAGATTC -3'
(R):5'- TTGAGAGCTCTGAGGCAGTG -3'

Sequencing Primer
(F):5'- TTCAGAGTCATACCATGTAATCACC -3'
(R):5'- TCACTGCAGTTCCCGGAG -3'
Posted On 2020-10-20