Incidental Mutation 'R8424:Keap1'
ID 653362
Institutional Source Beutler Lab
Gene Symbol Keap1
Ensembl Gene ENSMUSG00000003308
Gene Name kelch-like ECH-associated protein 1
Synonyms INrf2, ring canal protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock # R8424 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 21229730-21239361 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 21230790 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 596 (R596L)
Ref Sequence ENSEMBL: ENSMUSP00000062467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049567] [ENSMUST00000164812] [ENSMUST00000193982] [ENSMUST00000194542] [ENSMUST00000216436]
AlphaFold Q9Z2X8
PDB Structure Structural basis for the defects of human lung cancer somatic mutations in the repression activity of Keap1 on Nrf2 [X-RAY DIFFRACTION]
Structural basis for the defects of human lung cancer somatic mutations in the repression activity of Keap1 on Nrf2 [X-RAY DIFFRACTION]
Crystal structure of the Keap1 protein in complexed with the N-terminal region of the Nrf2 transcription factor [X-RAY DIFFRACTION]
Crystal structure of Keap1 complexed with Prothymosin alpha [X-RAY DIFFRACTION]
Crystal Structure of Keap1 in Complex with Sequestosome-1/p62 [X-RAY DIFFRACTION]
Crystal Structure of Keap1 in Complex with phosphorylated p62 [X-RAY DIFFRACTION]
Crystal Structure of Keap1 in Complex with the N-terminal region of the Nrf2 transcription factor [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000049567
AA Change: R596L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000062467
Gene: ENSMUSG00000003308
AA Change: R596L

DomainStartEndE-ValueType
BTB 77 179 1.33e-25 SMART
BACK 184 286 2.19e-34 SMART
Kelch 327 372 4.2e-11 SMART
Kelch 373 423 4.1e-14 SMART
Kelch 424 470 5.12e-15 SMART
Kelch 471 517 1.02e-18 SMART
Kelch 518 564 1.23e-17 SMART
Kelch 565 611 7.58e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164812
AA Change: R596L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000131029
Gene: ENSMUSG00000003308
AA Change: R596L

DomainStartEndE-ValueType
BTB 77 179 1.33e-25 SMART
BACK 184 286 2.19e-34 SMART
Kelch 327 372 4.2e-11 SMART
Kelch 373 423 4.1e-14 SMART
Kelch 424 470 5.12e-15 SMART
Kelch 471 517 1.02e-18 SMART
Kelch 518 564 1.23e-17 SMART
Kelch 565 611 7.58e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193982
AA Change: R596L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000141840
Gene: ENSMUSG00000003308
AA Change: R596L

DomainStartEndE-ValueType
BTB 77 179 1.33e-25 SMART
BACK 184 286 2.19e-34 SMART
Kelch 327 372 4.2e-11 SMART
Kelch 373 423 4.1e-14 SMART
Kelch 424 470 5.12e-15 SMART
Kelch 471 517 1.02e-18 SMART
Kelch 518 564 1.23e-17 SMART
Kelch 565 611 7.58e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194542
AA Change: R596L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000141807
Gene: ENSMUSG00000003308
AA Change: R596L

DomainStartEndE-ValueType
BTB 77 179 1.33e-25 SMART
BACK 184 286 2.19e-34 SMART
Kelch 327 372 4.2e-11 SMART
Kelch 373 423 4.1e-14 SMART
Kelch 424 470 5.12e-15 SMART
Kelch 471 517 1.02e-18 SMART
Kelch 518 564 1.23e-17 SMART
Kelch 565 611 7.58e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216436
AA Change: R592L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing KELCH-1 like domains, as well as a BTB/POZ domain. Kelch-like ECH-associated protein 1 interacts with NF-E2-related factor 2 in a redox-sensitive manner and the dissociation of the proteins in the cytoplasm is followed by transportation of NF-E2-related factor 2 to the nucleus. This interaction results in the expression of the catalytic subunit of gamma-glutamylcysteine synthetase. Two alternatively spliced transcript variants encoding the same isoform have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit scaly skin, hyperkeratosis of the esophagus and stomach mucosa, and die around 3 weeks of age, putatively due to malnutrition resulting from the abnormal alimentary epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 79,297,137 P42S probably damaging Het
Acss2 A G 2: 155,574,618 T694A unknown Het
Adar C T 3: 89,735,994 P394L probably damaging Het
Alx4 A G 2: 93,677,469 M370V probably benign Het
Bag6 T A 17: 35,146,854 L1089Q probably damaging Het
Bms1 T C 6: 118,388,760 Y1155C probably benign Het
Cbl G A 9: 44,152,854 T795I possibly damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdc5l C A 17: 45,415,600 A349S probably benign Het
Cdh5 G A 8: 104,129,371 R312H probably benign Het
Cdk5rap1 T C 2: 154,346,012 T465A probably damaging Het
Cep135 C T 5: 76,594,059 T114I possibly damaging Het
Csrp1 T C 1: 135,739,450 V17A probably damaging Het
Cutal T C 2: 34,887,792 S105P probably benign Het
Dgki C A 6: 36,850,915 V1016L probably benign Het
Dnmt1 T C 9: 20,918,540 N746S probably benign Het
Ep400 A T 5: 110,693,278 V1796E unknown Het
Fam83a T A 15: 58,009,650 S292T possibly damaging Het
Hist1h2ab A G 13: 23,751,284 Y51C probably damaging Het
Klhl5 A C 5: 65,162,962 T620P probably benign Het
Lbhd1 T A 19: 8,883,977 D16E possibly damaging Het
Nadk2 T C 15: 9,083,334 V110A possibly damaging Het
Ncbp1 A T 4: 46,144,839 H30L probably benign Het
Olfr203 A T 16: 59,303,409 L85F possibly damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pmp22 G T 11: 63,133,076 probably benign Het
Rc3h1 C T 1: 160,965,772 L1076F probably damaging Het
Ryr3 T C 2: 112,841,894 I1431V possibly damaging Het
S100a7a T A 3: 90,655,561 H18Q probably damaging Het
Scd2 G T 19: 44,301,304 C246F probably benign Het
Serpina1c T C 12: 103,896,037 T340A possibly damaging Het
Setd5 A G 6: 113,149,683 E1227G probably benign Het
Sh3yl1 G A 12: 30,924,863 R71H probably damaging Het
Spry2 A G 14: 105,893,402 S117P probably damaging Het
Srcap T C 7: 127,542,388 V1780A probably benign Het
Tas2r130 T G 6: 131,630,827 T2P probably benign Het
Tiam2 T A 17: 3,516,041 F1454I probably damaging Het
Tiam2 T C 17: 3,516,042 F1454S probably damaging Het
Tmem173 A C 18: 35,739,170 I93S probably benign Het
Tnpo3 A G 6: 29,555,206 S793P probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Ubap2l A T 3: 90,021,031 D535E probably damaging Het
Ube2h A G 6: 30,260,941 S65P probably damaging Het
Vmn1r203 T C 13: 22,524,834 S262P probably damaging Het
Wfdc8 A G 2: 164,603,158 F179S probably benign Het
Wnk1 T C 6: 119,934,427 T2153A unknown Het
Zfhx3 G T 8: 108,856,753 G1084V probably damaging Het
Zfp273 A G 13: 67,822,352 N40D probably benign Het
Zfp352 C T 4: 90,224,243 P207S possibly damaging Het
Zfp952 T A 17: 33,003,217 F223L probably benign Het
Other mutations in Keap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
cubs UTSW 9 21237553 missense probably benign 0.07
R1917:Keap1 UTSW 9 21233806 missense probably benign
R4296:Keap1 UTSW 9 21233986 missense probably damaging 1.00
R4590:Keap1 UTSW 9 21237609 missense probably damaging 0.97
R4723:Keap1 UTSW 9 21231410 missense probably benign 0.15
R4947:Keap1 UTSW 9 21237553 missense probably benign 0.07
R4952:Keap1 UTSW 9 21237286 missense probably damaging 1.00
R5024:Keap1 UTSW 9 21237226 missense probably damaging 1.00
R6001:Keap1 UTSW 9 21230839 missense possibly damaging 0.45
R6508:Keap1 UTSW 9 21231714 missense possibly damaging 0.67
R7075:Keap1 UTSW 9 21231256 missense probably benign 0.30
R7184:Keap1 UTSW 9 21233838 missense probably benign
R7520:Keap1 UTSW 9 21233491 missense probably benign
R7531:Keap1 UTSW 9 21237327 missense probably benign 0.20
R7811:Keap1 UTSW 9 21237660 missense possibly damaging 0.92
R8976:Keap1 UTSW 9 21231367 missense probably damaging 1.00
R9154:Keap1 UTSW 9 21230825 nonsense probably null
R9521:Keap1 UTSW 9 21231840 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGATGACTTCTTCTGCCG -3'
(R):5'- TGAGTATAAAAGCCAGAGAGTCCC -3'

Sequencing Primer
(F):5'- TCGGCCCTGTGTTTTCTG -3'
(R):5'- GGGGCTCTAGACTGAACCACATTC -3'
Posted On 2020-10-20