Incidental Mutation 'R8424:Pmp22'
ID653364
Institutional Source Beutler Lab
Gene Symbol Pmp22
Ensembl Gene ENSMUSG00000018217
Gene Nameperipheral myelin protein 22
SynonymsGas-3
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_008885.2; MGI:97631

Is this an essential gene? Possibly non essential (E-score: 0.458) question?
Stock #R8424 (G1)
Quality Score184.009
Status Not validated
Chromosome11
Chromosomal Location63128982-63159547 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 63133076 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018361] [ENSMUST00000108700] [ENSMUST00000108701] [ENSMUST00000108702]
Predicted Effect probably benign
Transcript: ENSMUST00000018361
SMART Domains Protein: ENSMUSP00000018361
Gene: ENSMUSG00000018217

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.8e-50 PFAM
Pfam:Claudin_2 13 155 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108700
SMART Domains Protein: ENSMUSP00000104340
Gene: ENSMUSG00000018217

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.8e-50 PFAM
Pfam:Claudin_2 13 155 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108701
SMART Domains Protein: ENSMUSP00000104341
Gene: ENSMUSG00000018217

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.7e-50 PFAM
Pfam:Claudin_2 55 155 1.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108702
SMART Domains Protein: ENSMUSP00000104342
Gene: ENSMUSG00000018217

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.8e-50 PFAM
Pfam:Claudin_2 13 155 1.1e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype Strain: 2447704; 3614822
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is a major component of myelin in the peripheral nervous system. Studies suggest two alternately used promoters drive tissue-specific expression. Various mutations of this gene are causes of Charcot-Marie-Tooth disease Type IA, Dejerine-Sottas syndrome, and hereditary neuropathy with liability to pressure palsies. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice with one or two copies of several mutations exhibit tremors, a tendency toward seizures, and partial paralysis associated with demyelination and loss of peripheral axons. Mutants have high juvenile mortality and males are often sterile. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(4) Spontaneous(3) Chemically induced(4)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 79,297,137 P42S probably damaging Het
Acss2 A G 2: 155,574,618 T694A unknown Het
Adar C T 3: 89,735,994 P394L probably damaging Het
Alx4 A G 2: 93,677,469 M370V probably benign Het
Bag6 T A 17: 35,146,854 L1089Q probably damaging Het
Bms1 T C 6: 118,388,760 Y1155C probably benign Het
Cbl G A 9: 44,152,854 T795I possibly damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdc5l C A 17: 45,415,600 A349S probably benign Het
Cdh5 G A 8: 104,129,371 R312H probably benign Het
Cdk5rap1 T C 2: 154,346,012 T465A probably damaging Het
Cep135 C T 5: 76,594,059 T114I possibly damaging Het
Csrp1 T C 1: 135,739,450 V17A probably damaging Het
Cutal T C 2: 34,887,792 S105P probably benign Het
Dgki C A 6: 36,850,915 V1016L probably benign Het
Dnmt1 T C 9: 20,918,540 N746S probably benign Het
Ep400 A T 5: 110,693,278 V1796E unknown Het
Fam83a T A 15: 58,009,650 S292T possibly damaging Het
Hist1h2ab A G 13: 23,751,284 Y51C probably damaging Het
Keap1 C A 9: 21,230,790 R596L probably benign Het
Klhl5 A C 5: 65,162,962 T620P probably benign Het
Lbhd1 T A 19: 8,883,977 D16E possibly damaging Het
Nadk2 T C 15: 9,083,334 V110A possibly damaging Het
Ncbp1 A T 4: 46,144,839 H30L probably benign Het
Olfr203 A T 16: 59,303,409 L85F possibly damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Rc3h1 C T 1: 160,965,772 L1076F probably damaging Het
Ryr3 T C 2: 112,841,894 I1431V possibly damaging Het
S100a7a T A 3: 90,655,561 H18Q probably damaging Het
Scd2 G T 19: 44,301,304 C246F probably benign Het
Serpina1c T C 12: 103,896,037 T340A possibly damaging Het
Setd5 A G 6: 113,149,683 E1227G probably benign Het
Sh3yl1 G A 12: 30,924,863 R71H probably damaging Het
Spry2 A G 14: 105,893,402 S117P probably damaging Het
Srcap T C 7: 127,542,388 V1780A probably benign Het
Tas2r130 T G 6: 131,630,827 T2P probably benign Het
Tiam2 T A 17: 3,516,041 F1454I probably damaging Het
Tiam2 T C 17: 3,516,042 F1454S probably damaging Het
Tmem173 A C 18: 35,739,170 I93S probably benign Het
Tnpo3 A G 6: 29,555,206 S793P probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Ubap2l A T 3: 90,021,031 D535E probably damaging Het
Ube2h A G 6: 30,260,941 S65P probably damaging Het
Vmn1r203 T C 13: 22,524,834 S262P probably damaging Het
Wfdc8 A G 2: 164,603,158 F179S probably benign Het
Wnk1 T C 6: 119,934,427 T2153A unknown Het
Zfhx3 G T 8: 108,856,753 G1084V probably damaging Het
Zfp273 A G 13: 67,822,352 N40D probably benign Het
Zfp352 C T 4: 90,224,243 P207S possibly damaging Het
Zfp952 T A 17: 33,003,217 F223L probably benign Het
Other mutations in Pmp22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01780:Pmp22 APN 11 63158308 missense probably benign
IGL02350:Pmp22 APN 11 63158308 missense probably benign
IGL02357:Pmp22 APN 11 63158308 missense probably benign
IGL02423:Pmp22 APN 11 63158292 missense possibly damaging 0.94
IGL03107:Pmp22 APN 11 63158309 missense probably benign
PIT4431001:Pmp22 UTSW 11 63151241 missense probably benign 0.00
R0025:Pmp22 UTSW 11 63158250 critical splice acceptor site probably null
R0025:Pmp22 UTSW 11 63158250 critical splice acceptor site probably null
R0453:Pmp22 UTSW 11 63151103 intron probably benign
R0561:Pmp22 UTSW 11 63134424 missense probably damaging 1.00
R3858:Pmp22 UTSW 11 63134475 missense probably benign 0.00
R5107:Pmp22 UTSW 11 63158411 missense probably damaging 0.99
R6573:Pmp22 UTSW 11 63158273 missense probably damaging 1.00
R6574:Pmp22 UTSW 11 63158273 missense probably damaging 1.00
R6575:Pmp22 UTSW 11 63158273 missense probably damaging 1.00
R7455:Pmp22 UTSW 11 63134513 splice site probably null
R7599:Pmp22 UTSW 11 63158348 missense probably damaging 1.00
R8008:Pmp22 UTSW 11 63158407 missense probably damaging 1.00
R8506:Pmp22 UTSW 11 63158264 missense probably damaging 1.00
R8812:Pmp22 UTSW 11 63158413 makesense probably null
Predicted Primers PCR Primer
(F):5'- GAATCCACCCTGTGACTGGG -3'
(R):5'- CACTCACGCTGACGATGGTG -3'

Sequencing Primer
(F):5'- AGTCCCAAGGGCCCTGAAAG -3'
(R):5'- CGCTGACGATGGTGGAGAC -3'
Posted On2020-10-20