Incidental Mutation 'R8424:Zfp273'
ID653370
Institutional Source Beutler Lab
Gene Symbol Zfp273
Ensembl Gene ENSMUSG00000030446
Gene Namezinc finger protein 273
Synonyms6820416H06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R8424 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location67813740-67827002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67822352 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 40 (N40D)
Ref Sequence ENSEMBL: ENSMUSP00000137903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012725] [ENSMUST00000181391]
Predicted Effect probably benign
Transcript: ENSMUST00000012725
AA Change: N7D

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000012725
Gene: ENSMUSG00000030446
AA Change: N7D

DomainStartEndE-ValueType
KRAB 1 32 1.97e-1 SMART
ZnF_C2H2 48 70 1.95e-3 SMART
ZnF_C2H2 76 98 4.94e-5 SMART
ZnF_C2H2 104 126 6.32e-3 SMART
ZnF_C2H2 132 154 3.39e-3 SMART
ZnF_C2H2 160 182 2.99e-4 SMART
ZnF_C2H2 188 210 4.24e-4 SMART
ZnF_C2H2 216 238 1.45e-2 SMART
ZnF_C2H2 244 266 1.1e-2 SMART
ZnF_C2H2 272 294 2.91e-2 SMART
ZnF_C2H2 300 322 6.78e-3 SMART
ZnF_C2H2 328 350 2.71e-2 SMART
ZnF_C2H2 356 378 4.17e-3 SMART
ZnF_C2H2 384 406 1.38e-3 SMART
ZnF_C2H2 412 434 1.98e-4 SMART
ZnF_C2H2 440 462 1.2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181391
AA Change: N40D

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000137903
Gene: ENSMUSG00000030446
AA Change: N40D

DomainStartEndE-ValueType
KRAB 5 65 9.25e-28 SMART
ZnF_C2H2 81 103 1.95e-3 SMART
ZnF_C2H2 109 131 4.94e-5 SMART
ZnF_C2H2 137 159 6.32e-3 SMART
ZnF_C2H2 165 187 3.39e-3 SMART
ZnF_C2H2 193 215 2.99e-4 SMART
ZnF_C2H2 221 243 4.24e-4 SMART
ZnF_C2H2 249 271 1.45e-2 SMART
ZnF_C2H2 277 299 1.1e-2 SMART
ZnF_C2H2 305 327 2.91e-2 SMART
ZnF_C2H2 333 355 6.78e-3 SMART
ZnF_C2H2 361 383 2.71e-2 SMART
ZnF_C2H2 389 411 4.17e-3 SMART
ZnF_C2H2 417 439 1.38e-3 SMART
ZnF_C2H2 445 467 1.98e-4 SMART
ZnF_C2H2 473 495 1.2e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 79,297,137 P42S probably damaging Het
Acss2 A G 2: 155,574,618 T694A unknown Het
Adar C T 3: 89,735,994 P394L probably damaging Het
Alx4 A G 2: 93,677,469 M370V probably benign Het
Bag6 T A 17: 35,146,854 L1089Q probably damaging Het
Bms1 T C 6: 118,388,760 Y1155C probably benign Het
Cbl G A 9: 44,152,854 T795I possibly damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdc5l C A 17: 45,415,600 A349S probably benign Het
Cdh5 G A 8: 104,129,371 R312H probably benign Het
Cdk5rap1 T C 2: 154,346,012 T465A probably damaging Het
Cep135 C T 5: 76,594,059 T114I possibly damaging Het
Csrp1 T C 1: 135,739,450 V17A probably damaging Het
Cutal T C 2: 34,887,792 S105P probably benign Het
Dgki C A 6: 36,850,915 V1016L probably benign Het
Dnmt1 T C 9: 20,918,540 N746S probably benign Het
Ep400 A T 5: 110,693,278 V1796E unknown Het
Fam83a T A 15: 58,009,650 S292T possibly damaging Het
Hist1h2ab A G 13: 23,751,284 Y51C probably damaging Het
Keap1 C A 9: 21,230,790 R596L probably benign Het
Klhl5 A C 5: 65,162,962 T620P probably benign Het
Lbhd1 T A 19: 8,883,977 D16E possibly damaging Het
Nadk2 T C 15: 9,083,334 V110A possibly damaging Het
Ncbp1 A T 4: 46,144,839 H30L probably benign Het
Olfr203 A T 16: 59,303,409 L85F possibly damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pmp22 G T 11: 63,133,076 probably benign Het
Rc3h1 C T 1: 160,965,772 L1076F probably damaging Het
Ryr3 T C 2: 112,841,894 I1431V possibly damaging Het
S100a7a T A 3: 90,655,561 H18Q probably damaging Het
Scd2 G T 19: 44,301,304 C246F probably benign Het
Serpina1c T C 12: 103,896,037 T340A possibly damaging Het
Setd5 A G 6: 113,149,683 E1227G probably benign Het
Sh3yl1 G A 12: 30,924,863 R71H probably damaging Het
Spry2 A G 14: 105,893,402 S117P probably damaging Het
Srcap T C 7: 127,542,388 V1780A probably benign Het
Tas2r130 T G 6: 131,630,827 T2P probably benign Het
Tiam2 T A 17: 3,516,041 F1454I probably damaging Het
Tiam2 T C 17: 3,516,042 F1454S probably damaging Het
Tmem173 A C 18: 35,739,170 I93S probably benign Het
Tnpo3 A G 6: 29,555,206 S793P probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Ubap2l A T 3: 90,021,031 D535E probably damaging Het
Ube2h A G 6: 30,260,941 S65P probably damaging Het
Vmn1r203 T C 13: 22,524,834 S262P probably damaging Het
Wfdc8 A G 2: 164,603,158 F179S probably benign Het
Wnk1 T C 6: 119,934,427 T2153A unknown Het
Zfhx3 G T 8: 108,856,753 G1084V probably damaging Het
Zfp352 C T 4: 90,224,243 P207S possibly damaging Het
Zfp952 T A 17: 33,003,217 F223L probably benign Het
Other mutations in Zfp273
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03115:Zfp273 APN 13 67825650 missense probably damaging 1.00
R1969:Zfp273 UTSW 13 67825163 missense probably damaging 1.00
R2679:Zfp273 UTSW 13 67825776 missense probably benign 0.39
R3736:Zfp273 UTSW 13 67825507 nonsense probably null
R4832:Zfp273 UTSW 13 67825365 missense probably benign 0.01
R4896:Zfp273 UTSW 13 67825554 missense probably damaging 1.00
R5004:Zfp273 UTSW 13 67825554 missense probably damaging 1.00
R5223:Zfp273 UTSW 13 67826179 missense probably damaging 1.00
R5748:Zfp273 UTSW 13 67825331 missense probably damaging 1.00
R5948:Zfp273 UTSW 13 67825799 missense probably benign 0.43
R6102:Zfp273 UTSW 13 67822347 missense probably damaging 1.00
R6668:Zfp273 UTSW 13 67825124 missense probably damaging 0.99
R7192:Zfp273 UTSW 13 67825064 missense possibly damaging 0.82
R7478:Zfp273 UTSW 13 67825132 missense probably benign 0.30
R7792:Zfp273 UTSW 13 67826016 missense possibly damaging 0.71
R7874:Zfp273 UTSW 13 67825439 missense probably benign 0.00
R8261:Zfp273 UTSW 13 67825951 missense probably benign 0.12
R8716:Zfp273 UTSW 13 67825934 missense probably damaging 1.00
R8843:Zfp273 UTSW 13 67822268 missense possibly damaging 0.80
X0028:Zfp273 UTSW 13 67823142 missense probably benign 0.20
Z1088:Zfp273 UTSW 13 67825394 missense possibly damaging 0.91
Z1176:Zfp273 UTSW 13 67823146 missense probably null
Predicted Primers PCR Primer
(F):5'- AAGCTTGCTGACTTTGGTATTGAC -3'
(R):5'- TGGCCATATGGAACCAATCAAC -3'

Sequencing Primer
(F):5'- CCCTCTGTCATTCACAga -3'
(R):5'- TTCAATCCCAGCACTTAGGAGGTAG -3'
Posted On2020-10-20