Incidental Mutation 'R8424:Olfr203'
ID 653374
Institutional Source Beutler Lab
Gene Symbol Olfr203
Ensembl Gene ENSMUSG00000068182
Gene Name olfactory receptor 203
Synonyms MOR182-5, GA_x54KRFPKG5P-55517445-55518365
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock # R8424 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 59298881-59304413 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 59303409 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 85 (L85F)
Ref Sequence ENSEMBL: ENSMUSP00000149906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089305] [ENSMUST00000215893]
AlphaFold L7N205
Predicted Effect possibly damaging
Transcript: ENSMUST00000089305
AA Change: L86F

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000086719
Gene: ENSMUSG00000068182
AA Change: L86F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1e-46 PFAM
Pfam:7tm_1 41 290 7.6e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215893
AA Change: L85F

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 79,297,137 P42S probably damaging Het
Acss2 A G 2: 155,574,618 T694A unknown Het
Adar C T 3: 89,735,994 P394L probably damaging Het
Alx4 A G 2: 93,677,469 M370V probably benign Het
Bag6 T A 17: 35,146,854 L1089Q probably damaging Het
Bms1 T C 6: 118,388,760 Y1155C probably benign Het
Cbl G A 9: 44,152,854 T795I possibly damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdc5l C A 17: 45,415,600 A349S probably benign Het
Cdh5 G A 8: 104,129,371 R312H probably benign Het
Cdk5rap1 T C 2: 154,346,012 T465A probably damaging Het
Cep135 C T 5: 76,594,059 T114I possibly damaging Het
Csrp1 T C 1: 135,739,450 V17A probably damaging Het
Cutal T C 2: 34,887,792 S105P probably benign Het
Dgki C A 6: 36,850,915 V1016L probably benign Het
Dnmt1 T C 9: 20,918,540 N746S probably benign Het
Ep400 A T 5: 110,693,278 V1796E unknown Het
Fam83a T A 15: 58,009,650 S292T possibly damaging Het
Hist1h2ab A G 13: 23,751,284 Y51C probably damaging Het
Keap1 C A 9: 21,230,790 R596L probably benign Het
Klhl5 A C 5: 65,162,962 T620P probably benign Het
Lbhd1 T A 19: 8,883,977 D16E possibly damaging Het
Nadk2 T C 15: 9,083,334 V110A possibly damaging Het
Ncbp1 A T 4: 46,144,839 H30L probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pmp22 G T 11: 63,133,076 probably benign Het
Rc3h1 C T 1: 160,965,772 L1076F probably damaging Het
Ryr3 T C 2: 112,841,894 I1431V possibly damaging Het
S100a7a T A 3: 90,655,561 H18Q probably damaging Het
Scd2 G T 19: 44,301,304 C246F probably benign Het
Serpina1c T C 12: 103,896,037 T340A possibly damaging Het
Setd5 A G 6: 113,149,683 E1227G probably benign Het
Sh3yl1 G A 12: 30,924,863 R71H probably damaging Het
Spry2 A G 14: 105,893,402 S117P probably damaging Het
Srcap T C 7: 127,542,388 V1780A probably benign Het
Tas2r130 T G 6: 131,630,827 T2P probably benign Het
Tiam2 T A 17: 3,516,041 F1454I probably damaging Het
Tiam2 T C 17: 3,516,042 F1454S probably damaging Het
Tmem173 A C 18: 35,739,170 I93S probably benign Het
Tnpo3 A G 6: 29,555,206 S793P probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Ubap2l A T 3: 90,021,031 D535E probably damaging Het
Ube2h A G 6: 30,260,941 S65P probably damaging Het
Vmn1r203 T C 13: 22,524,834 S262P probably damaging Het
Wfdc8 A G 2: 164,603,158 F179S probably benign Het
Wnk1 T C 6: 119,934,427 T2153A unknown Het
Zfhx3 G T 8: 108,856,753 G1084V probably damaging Het
Zfp273 A G 13: 67,822,352 N40D probably benign Het
Zfp352 C T 4: 90,224,243 P207S possibly damaging Het
Zfp952 T A 17: 33,003,217 F223L probably benign Het
Other mutations in Olfr203
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Olfr203 APN 16 59303633 missense probably damaging 0.99
IGL02294:Olfr203 APN 16 59303612 missense probably damaging 1.00
IGL02412:Olfr203 APN 16 59303192 missense probably damaging 1.00
IGL02899:Olfr203 APN 16 59303286 missense probably damaging 1.00
R0792:Olfr203 UTSW 16 59303989 missense probably damaging 0.99
R1551:Olfr203 UTSW 16 59303403 missense probably benign 0.03
R1701:Olfr203 UTSW 16 59303288 missense probably benign 0.23
R1975:Olfr203 UTSW 16 59303728 missense probably damaging 0.98
R2272:Olfr203 UTSW 16 59303444 missense possibly damaging 0.55
R5199:Olfr203 UTSW 16 59303740 missense probably benign
R5843:Olfr203 UTSW 16 59303361 missense probably damaging 1.00
R5928:Olfr203 UTSW 16 59303158 missense probably damaging 1.00
R6708:Olfr203 UTSW 16 59304053 missense probably damaging 1.00
R6747:Olfr203 UTSW 16 59303641 missense probably benign 0.03
R6894:Olfr203 UTSW 16 59303779 missense probably damaging 0.98
R7324:Olfr203 UTSW 16 59303248 missense probably benign
R7380:Olfr203 UTSW 16 59304028 missense probably damaging 1.00
R7612:Olfr203 UTSW 16 59303627 missense probably damaging 1.00
R7775:Olfr203 UTSW 16 59303251 missense probably damaging 1.00
R8010:Olfr203 UTSW 16 59303504 missense probably damaging 1.00
R8408:Olfr203 UTSW 16 59304055 nonsense probably null
R8746:Olfr203 UTSW 16 59303610 missense probably benign 0.03
Z1176:Olfr203 UTSW 16 59303169 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACTGCGTTTATTCTCAGAGG -3'
(R):5'- AGTGCACACTCTGTTGGACATC -3'

Sequencing Primer
(F):5'- AGATCTTCCAGAGCTGCAAGTTC -3'
(R):5'- TCTGTTGGACATCACCACAAGATAG -3'
Posted On 2020-10-20