Incidental Mutation 'R8424:Zfp952'
ID653377
Institutional Source Beutler Lab
Gene Symbol Zfp952
Ensembl Gene ENSMUSG00000053390
Gene Namezinc finger protein 952
SynonymsC920016K16Rik
Accession Numbers

Genbank: NM_001045559; MGI: 2441928

Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R8424 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location32993129-33005457 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33003217 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 223 (F223L)
Ref Sequence ENSEMBL: ENSMUSP00000084949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087666] [ENSMUST00000157017]
Predicted Effect probably benign
Transcript: ENSMUST00000087666
AA Change: F223L

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000084949
Gene: ENSMUSG00000053390
AA Change: F223L

DomainStartEndE-ValueType
KRAB 10 73 4.6e-14 SMART
ZnF_C2H2 251 273 3.44e-4 SMART
ZnF_C2H2 279 301 1.28e-3 SMART
ZnF_C2H2 307 329 1.36e-2 SMART
ZnF_C2H2 335 357 2.75e-3 SMART
ZnF_C2H2 363 385 9.44e-2 SMART
ZnF_C2H2 391 413 1.47e-3 SMART
ZnF_C2H2 419 441 2.91e-2 SMART
ZnF_C2H2 447 469 2.57e-3 SMART
ZnF_C2H2 475 497 1.43e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000157017
SMART Domains Protein: ENSMUSP00000123066
Gene: ENSMUSG00000053390

DomainStartEndE-ValueType
Blast:KRAB 1 35 4e-17 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 79,297,137 P42S probably damaging Het
Acss2 A G 2: 155,574,618 T694A unknown Het
Adar C T 3: 89,735,994 P394L probably damaging Het
Alx4 A G 2: 93,677,469 M370V probably benign Het
Bag6 T A 17: 35,146,854 L1089Q probably damaging Het
Bms1 T C 6: 118,388,760 Y1155C probably benign Het
Cbl G A 9: 44,152,854 T795I possibly damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdc5l C A 17: 45,415,600 A349S probably benign Het
Cdh5 G A 8: 104,129,371 R312H probably benign Het
Cdk5rap1 T C 2: 154,346,012 T465A probably damaging Het
Cep135 C T 5: 76,594,059 T114I possibly damaging Het
Csrp1 T C 1: 135,739,450 V17A probably damaging Het
Cutal T C 2: 34,887,792 S105P probably benign Het
Dgki C A 6: 36,850,915 V1016L probably benign Het
Dnmt1 T C 9: 20,918,540 N746S probably benign Het
Ep400 A T 5: 110,693,278 V1796E unknown Het
Fam83a T A 15: 58,009,650 S292T possibly damaging Het
Hist1h2ab A G 13: 23,751,284 Y51C probably damaging Het
Keap1 C A 9: 21,230,790 R596L probably benign Het
Klhl5 A C 5: 65,162,962 T620P probably benign Het
Lbhd1 T A 19: 8,883,977 D16E possibly damaging Het
Nadk2 T C 15: 9,083,334 V110A possibly damaging Het
Ncbp1 A T 4: 46,144,839 H30L probably benign Het
Olfr203 A T 16: 59,303,409 L85F possibly damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pmp22 G T 11: 63,133,076 probably benign Het
Rc3h1 C T 1: 160,965,772 L1076F probably damaging Het
Ryr3 T C 2: 112,841,894 I1431V possibly damaging Het
S100a7a T A 3: 90,655,561 H18Q probably damaging Het
Scd2 G T 19: 44,301,304 C246F probably benign Het
Serpina1c T C 12: 103,896,037 T340A possibly damaging Het
Setd5 A G 6: 113,149,683 E1227G probably benign Het
Sh3yl1 G A 12: 30,924,863 R71H probably damaging Het
Spry2 A G 14: 105,893,402 S117P probably damaging Het
Srcap T C 7: 127,542,388 V1780A probably benign Het
Tas2r130 T G 6: 131,630,827 T2P probably benign Het
Tiam2 T A 17: 3,516,041 F1454I probably damaging Het
Tiam2 T C 17: 3,516,042 F1454S probably damaging Het
Tmem173 A C 18: 35,739,170 I93S probably benign Het
Tnpo3 A G 6: 29,555,206 S793P probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Ubap2l A T 3: 90,021,031 D535E probably damaging Het
Ube2h A G 6: 30,260,941 S65P probably damaging Het
Vmn1r203 T C 13: 22,524,834 S262P probably damaging Het
Wfdc8 A G 2: 164,603,158 F179S probably benign Het
Wnk1 T C 6: 119,934,427 T2153A unknown Het
Zfhx3 G T 8: 108,856,753 G1084V probably damaging Het
Zfp273 A G 13: 67,822,352 N40D probably benign Het
Zfp352 C T 4: 90,224,243 P207S possibly damaging Het
Other mutations in Zfp952
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01865:Zfp952 APN 17 33002817 missense probably benign 0.00
IGL02560:Zfp952 APN 17 33002819 nonsense probably null
IGL03056:Zfp952 APN 17 33002766 missense probably damaging 0.98
IGL03151:Zfp952 APN 17 33003008 missense probably benign 0.01
0152:Zfp952 UTSW 17 33003221 splice site probably null
R0508:Zfp952 UTSW 17 33003005 missense possibly damaging 0.90
R1936:Zfp952 UTSW 17 33003669 missense possibly damaging 0.71
R3882:Zfp952 UTSW 17 33001975 nonsense probably null
R4560:Zfp952 UTSW 17 33003954 missense probably benign 0.33
R4649:Zfp952 UTSW 17 33002925 missense probably damaging 0.99
R7103:Zfp952 UTSW 17 33003632 missense possibly damaging 0.94
R7207:Zfp952 UTSW 17 33003515 missense possibly damaging 0.93
R7209:Zfp952 UTSW 17 33003470 missense possibly damaging 0.71
R7508:Zfp952 UTSW 17 33003782 missense probably benign 0.06
R7699:Zfp952 UTSW 17 33002009 missense possibly damaging 0.53
R8445:Zfp952 UTSW 17 33003578 missense possibly damaging 0.78
Z1177:Zfp952 UTSW 17 33003104 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGAGTCCTTTCAGACAAAGCAAAG -3'
(R):5'- CCACATTGCTTACATACATATGGCC -3'

Sequencing Primer
(F):5'- GCAAAGTCCTCCTCGAGAG -3'
(R):5'- ACATACATATGGCCTCTCCCCG -3'
Posted On2020-10-20