Incidental Mutation 'R8424:Cdc5l'
ID653379
Institutional Source Beutler Lab
Gene Symbol Cdc5l
Ensembl Gene ENSMUSG00000023932
Gene Namecell division cycle 5-like (S. pombe)
SynonymsPCDC5RP, 1200002I02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R8424 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location45391892-45433707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45415600 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 349 (A349S)
Ref Sequence ENSEMBL: ENSMUSP00000024727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024727]
Predicted Effect probably benign
Transcript: ENSMUST00000024727
AA Change: A349S

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000024727
Gene: ENSMUSG00000023932
AA Change: A349S

DomainStartEndE-ValueType
SANT 7 56 4.41e-15 SMART
SANT 59 106 6.29e-11 SMART
coiled coil region 150 181 N/A INTRINSIC
Blast:SANT 187 233 5e-23 BLAST
low complexity region 258 271 N/A INTRINSIC
Pfam:Myb_Cef 404 655 3.1e-85 PFAM
low complexity region 706 718 N/A INTRINSIC
coiled coil region 764 802 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares a significant similarity with Schizosaccharomyces pombe cdc5 gene product, which is a cell cycle regulator important for G2/M transition. This protein has been demonstrated to act as a positive regulator of cell cycle G2/M progression. It was also found to be an essential component of a non-snRNA spliceosome, which contains at least five additional protein factors and is required for the second catalytic step of pre-mRNA splicing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 79,297,137 P42S probably damaging Het
Acss2 A G 2: 155,574,618 T694A unknown Het
Adar C T 3: 89,735,994 P394L probably damaging Het
Alx4 A G 2: 93,677,469 M370V probably benign Het
Bag6 T A 17: 35,146,854 L1089Q probably damaging Het
Bms1 T C 6: 118,388,760 Y1155C probably benign Het
Cbl G A 9: 44,152,854 T795I possibly damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdh5 G A 8: 104,129,371 R312H probably benign Het
Cdk5rap1 T C 2: 154,346,012 T465A probably damaging Het
Cep135 C T 5: 76,594,059 T114I possibly damaging Het
Csrp1 T C 1: 135,739,450 V17A probably damaging Het
Cutal T C 2: 34,887,792 S105P probably benign Het
Dgki C A 6: 36,850,915 V1016L probably benign Het
Dnmt1 T C 9: 20,918,540 N746S probably benign Het
Ep400 A T 5: 110,693,278 V1796E unknown Het
Fam83a T A 15: 58,009,650 S292T possibly damaging Het
Hist1h2ab A G 13: 23,751,284 Y51C probably damaging Het
Keap1 C A 9: 21,230,790 R596L probably benign Het
Klhl5 A C 5: 65,162,962 T620P probably benign Het
Lbhd1 T A 19: 8,883,977 D16E possibly damaging Het
Nadk2 T C 15: 9,083,334 V110A possibly damaging Het
Ncbp1 A T 4: 46,144,839 H30L probably benign Het
Olfr203 A T 16: 59,303,409 L85F possibly damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pmp22 G T 11: 63,133,076 probably benign Het
Rc3h1 C T 1: 160,965,772 L1076F probably damaging Het
Ryr3 T C 2: 112,841,894 I1431V possibly damaging Het
S100a7a T A 3: 90,655,561 H18Q probably damaging Het
Scd2 G T 19: 44,301,304 C246F probably benign Het
Serpina1c T C 12: 103,896,037 T340A possibly damaging Het
Setd5 A G 6: 113,149,683 E1227G probably benign Het
Sh3yl1 G A 12: 30,924,863 R71H probably damaging Het
Spry2 A G 14: 105,893,402 S117P probably damaging Het
Srcap T C 7: 127,542,388 V1780A probably benign Het
Tas2r130 T G 6: 131,630,827 T2P probably benign Het
Tiam2 T A 17: 3,516,041 F1454I probably damaging Het
Tiam2 T C 17: 3,516,042 F1454S probably damaging Het
Tmem173 A C 18: 35,739,170 I93S probably benign Het
Tnpo3 A G 6: 29,555,206 S793P probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Ubap2l A T 3: 90,021,031 D535E probably damaging Het
Ube2h A G 6: 30,260,941 S65P probably damaging Het
Vmn1r203 T C 13: 22,524,834 S262P probably damaging Het
Wfdc8 A G 2: 164,603,158 F179S probably benign Het
Wnk1 T C 6: 119,934,427 T2153A unknown Het
Zfhx3 G T 8: 108,856,753 G1084V probably damaging Het
Zfp273 A G 13: 67,822,352 N40D probably benign Het
Zfp352 C T 4: 90,224,243 P207S possibly damaging Het
Zfp952 T A 17: 33,003,217 F223L probably benign Het
Other mutations in Cdc5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Cdc5l APN 17 45404676 missense probably damaging 0.98
IGL01629:Cdc5l APN 17 45413190 missense probably benign 0.26
IGL02596:Cdc5l APN 17 45424604 splice site probably benign
IGL02973:Cdc5l APN 17 45404647 missense probably benign 0.31
IGL03102:Cdc5l APN 17 45407931 missense probably damaging 0.99
IGL03113:Cdc5l APN 17 45433422 missense possibly damaging 0.47
R0255:Cdc5l UTSW 17 45415684 missense probably damaging 1.00
R0333:Cdc5l UTSW 17 45393216 splice site probably benign
R0432:Cdc5l UTSW 17 45415684 missense probably damaging 1.00
R0532:Cdc5l UTSW 17 45415684 missense probably damaging 1.00
R0551:Cdc5l UTSW 17 45415684 missense probably damaging 1.00
R0839:Cdc5l UTSW 17 45393147 missense probably benign 0.10
R1462:Cdc5l UTSW 17 45408362 missense possibly damaging 0.77
R1462:Cdc5l UTSW 17 45408362 missense possibly damaging 0.77
R1483:Cdc5l UTSW 17 45408364 missense possibly damaging 0.79
R1634:Cdc5l UTSW 17 45404706 missense probably damaging 0.99
R1751:Cdc5l UTSW 17 45407805 missense probably benign
R1954:Cdc5l UTSW 17 45426516 splice site probably null
R1955:Cdc5l UTSW 17 45426516 splice site probably null
R2197:Cdc5l UTSW 17 45407819 missense probably benign 0.00
R2229:Cdc5l UTSW 17 45407846 missense probably benign 0.04
R4060:Cdc5l UTSW 17 45410890 missense probably benign 0.00
R4061:Cdc5l UTSW 17 45410890 missense probably benign 0.00
R4064:Cdc5l UTSW 17 45410890 missense probably benign 0.00
R4172:Cdc5l UTSW 17 45419772 missense probably damaging 1.00
R4334:Cdc5l UTSW 17 45410786 missense probably benign 0.00
R5093:Cdc5l UTSW 17 45393041 missense possibly damaging 0.50
R5268:Cdc5l UTSW 17 45415585 missense probably damaging 0.99
R5729:Cdc5l UTSW 17 45426569 missense probably benign 0.39
R6190:Cdc5l UTSW 17 45408017 missense probably benign 0.08
R6462:Cdc5l UTSW 17 45393049 missense probably benign
R6540:Cdc5l UTSW 17 45426644 missense probably damaging 1.00
R7232:Cdc5l UTSW 17 45427937 critical splice donor site probably null
R7381:Cdc5l UTSW 17 45411923 missense probably benign 0.00
R7589:Cdc5l UTSW 17 45410781 missense probably benign 0.41
R8120:Cdc5l UTSW 17 45407870 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGAATGAACAGCCGGTCAC -3'
(R):5'- ACGTGGGATTGCACTGTTAC -3'

Sequencing Primer
(F):5'- CCACTGAGCCTGCTAATTCAG -3'
(R):5'- ACTGTTAAATGGTTTACAGGGCTG -3'
Posted On2020-10-20