Incidental Mutation 'R8425:Adam23'
ID653384
Institutional Source Beutler Lab
Gene Symbol Adam23
Ensembl Gene ENSMUSG00000025964
Gene Namea disintegrin and metallopeptidase domain 23
SynonymsMDC3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8425 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location63445891-63596276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 63585377 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 788 (T788I)
Ref Sequence ENSEMBL: ENSMUSP00000084633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087374] [ENSMUST00000114103] [ENSMUST00000114107]
Predicted Effect probably damaging
Transcript: ENSMUST00000087374
AA Change: T788I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084633
Gene: ENSMUSG00000025964
AA Change: T788I

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
transmembrane domain 791 813 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114103
SMART Domains Protein: ENSMUSP00000139862
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114107
SMART Domains Protein: ENSMUSP00000109742
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
transmembrane domain 791 813 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the disintegrin family of membrane-anchored proteins that play a role in diverse biological processes such as brain development, fertilization, tumor development and inflammation. The encoded protein undergoes proteolytic processing to generate a mature polypeptide comprised of an inactive metalloprotease and disintegrin domains. Transgenic disruption of this gene in mice results in postnatal neurological defects including tremor and ataxia resulting in death by 2 weeks of age. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene are smaller than normal littermates, show delayed lung development, are lethal by postnatal day 14, and display severe tremor and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik T C 6: 124,347,786 E92G possibly damaging Het
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Aasdh A T 5: 76,886,277 Y476N possibly damaging Het
Abca13 G T 11: 9,314,623 V3002F possibly damaging Het
Adgrb2 A G 4: 130,005,057 T282A possibly damaging Het
Adgrg1 T C 8: 95,008,407 Y402H probably damaging Het
Agpat2 A T 2: 26,593,654 L257Q probably benign Het
Agpat3 A T 10: 78,282,377 V255E possibly damaging Het
Akap6 A G 12: 52,886,621 I299V probably benign Het
Anapc1 A T 2: 128,669,868 F468L probably damaging Het
Apob T A 12: 7,988,842 N431K possibly damaging Het
Asprv1 T A 6: 86,628,869 D232E probably benign Het
AW209491 A G 13: 14,637,336 Y258C probably damaging Het
Bach2 C T 4: 32,562,316 P261L probably benign Het
Cap2 T A 13: 46,609,732 I146K probably damaging Het
Catsperb A T 12: 101,602,769 Q900L probably benign Het
Ccdc187 A T 2: 26,281,536 V310D probably damaging Het
Cenpe G T 3: 135,242,627 G1275* probably null Het
Chd8 C T 14: 52,210,555 G1663D probably damaging Het
Col6a5 T A 9: 105,945,957 Y67F unknown Het
Cuzd1 G T 7: 131,317,991 T132K possibly damaging Het
Ddr2 T A 1: 170,036,016 probably benign Het
Ddx42 T C 11: 106,247,724 I783T probably benign Het
Dennd4a T A 9: 64,838,974 D47E probably damaging Het
Dirc2 A T 16: 35,735,597 N164K probably benign Het
Dvl2 T G 11: 70,007,847 W379G probably damaging Het
Ehbp1 A G 11: 22,013,495 L1160P probably damaging Het
Eml6 A G 11: 29,755,008 V1512A probably benign Het
Ephb6 T C 6: 41,618,646 S780P probably damaging Het
Exo5 G A 4: 120,922,363 L102F probably benign Het
Fam220a A T 5: 143,562,839 K2M possibly damaging Het
Fanci A T 7: 79,433,541 I731L probably benign Het
Gbp8 A G 5: 105,017,774 S338P probably damaging Het
H2-M11 T C 17: 36,548,757 I214T probably benign Het
Hhatl C A 9: 121,789,102 A196S probably benign Het
Hspg2 C A 4: 137,550,867 C2988* probably null Het
Ifi213 A G 1: 173,589,860 S329P probably benign Het
Lingo3 G T 10: 80,834,982 F371L probably benign Het
Maml2 C T 9: 13,620,117 T209I Het
Ndufaf3 T C 9: 108,566,983 probably benign Het
Nfatc2 C T 2: 168,536,296 G483E probably damaging Het
Npy6r A C 18: 44,276,003 T164P probably benign Het
Olfr117 T A 17: 37,660,084 N83I probably damaging Het
Olfr1221 T A 2: 89,112,393 N40Y probably damaging Het
Olfr132 T C 17: 38,131,036 D52G possibly damaging Het
Olfr1502 T C 19: 13,862,485 S231P probably benign Het
Olfr173 A G 16: 58,797,603 M81T probably benign Het
Olfr659 A G 7: 104,671,295 N198D probably damaging Het
Omg T C 11: 79,502,000 E344G possibly damaging Het
P2rx7 A G 5: 122,670,458 E301G probably damaging Het
Pkhd1l1 T C 15: 44,574,515 S3569P probably benign Het
Pkn3 G A 2: 30,086,501 probably null Het
Proc C T 18: 32,123,358 V419M probably damaging Het
Prss37 C T 6: 40,516,118 W138* probably null Het
Prss52 T A 14: 64,112,560 L212* probably null Het
Rnps1 A G 17: 24,418,169 K8E unknown Het
Rpf2 A T 10: 40,225,433 L202* probably null Het
Saraf C T 8: 34,165,448 P227L probably benign Het
Serpinb5 T A 1: 106,881,785 M307K possibly damaging Het
Slc46a1 T C 11: 78,468,645 S368P possibly damaging Het
Slfn8 T A 11: 83,004,615 Q455L possibly damaging Het
Sv2b A G 7: 75,117,599 M683T probably damaging Het
Tacc3 G T 5: 33,664,530 L211F unknown Het
Tbc1d8 A G 1: 39,381,409 V681A probably damaging Het
Tbkbp1 T C 11: 97,138,851 E493G unknown Het
Th A T 7: 142,894,086 V420E possibly damaging Het
Tmem132c T G 5: 127,564,357 V115G Het
Usp40 G A 1: 87,959,836 R915C probably benign Het
Wdr81 T A 11: 75,451,522 H973L possibly damaging Het
Zdhhc6 A G 19: 55,314,444 S42P probably benign Het
Zfp369 T A 13: 65,296,675 I544N possibly damaging Het
Other mutations in Adam23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Adam23 APN 1 63570954 missense probably damaging 0.99
IGL00957:Adam23 APN 1 63534311 missense probably benign 0.27
IGL01338:Adam23 APN 1 63551855 missense possibly damaging 0.50
IGL01835:Adam23 APN 1 63543119 missense probably damaging 1.00
IGL01928:Adam23 APN 1 63557446 missense probably damaging 1.00
IGL02563:Adam23 APN 1 63567977 splice site probably benign
IGL02981:Adam23 APN 1 63570953 missense probably damaging 0.99
IGL03037:Adam23 APN 1 63571017 missense possibly damaging 0.63
IGL03176:Adam23 APN 1 63563416 missense probably damaging 1.00
BB007:Adam23 UTSW 1 63585427 missense possibly damaging 0.89
BB017:Adam23 UTSW 1 63585427 missense possibly damaging 0.89
IGL02991:Adam23 UTSW 1 63547819 critical splice donor site probably null
R0057:Adam23 UTSW 1 63570919 missense probably damaging 1.00
R0057:Adam23 UTSW 1 63570919 missense probably damaging 1.00
R0125:Adam23 UTSW 1 63534356 missense probably benign 0.00
R0477:Adam23 UTSW 1 63557400 splice site probably benign
R0538:Adam23 UTSW 1 63567844 splice site probably benign
R0617:Adam23 UTSW 1 63543147 missense probably benign 0.06
R1506:Adam23 UTSW 1 63547814 missense probably benign 0.01
R1599:Adam23 UTSW 1 63570933 missense possibly damaging 0.65
R1755:Adam23 UTSW 1 63543170 missense probably damaging 1.00
R1813:Adam23 UTSW 1 63545572 missense probably benign 0.07
R1858:Adam23 UTSW 1 63557456 missense probably benign 0.12
R1896:Adam23 UTSW 1 63545572 missense probably benign 0.07
R1943:Adam23 UTSW 1 63477757 critical splice donor site probably null
R2147:Adam23 UTSW 1 63534362 splice site probably null
R2211:Adam23 UTSW 1 63573129 intron probably benign
R2233:Adam23 UTSW 1 63545512 missense probably benign
R2249:Adam23 UTSW 1 63535176 nonsense probably null
R2363:Adam23 UTSW 1 63557491 splice site probably null
R3800:Adam23 UTSW 1 63551774 nonsense probably null
R3974:Adam23 UTSW 1 63547729 nonsense probably null
R3975:Adam23 UTSW 1 63547729 nonsense probably null
R4066:Adam23 UTSW 1 63563425 missense probably damaging 1.00
R4382:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4383:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4384:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4385:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R5385:Adam23 UTSW 1 63551811 missense possibly damaging 0.74
R5435:Adam23 UTSW 1 63546453 missense possibly damaging 0.73
R6465:Adam23 UTSW 1 63566668 missense probably damaging 1.00
R6490:Adam23 UTSW 1 63557454 missense probably damaging 1.00
R6967:Adam23 UTSW 1 63563336 splice site probably null
R7139:Adam23 UTSW 1 63545577 missense probably damaging 1.00
R7584:Adam23 UTSW 1 63545462 missense probably damaging 1.00
R7930:Adam23 UTSW 1 63585427 missense possibly damaging 0.89
R8261:Adam23 UTSW 1 63528798 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- AGAGATGGACGTGTCTGACC -3'
(R):5'- CACTTCTGAGTAAAAGCGCG -3'

Sequencing Primer
(F):5'- CGTGTCTGACCTGGGATAAAGC -3'
(R):5'- GTGGTTGTAGTTGCATTATCAACACC -3'
Posted On2020-10-20