Incidental Mutation 'R8425:Ccdc187'
ID 653389
Institutional Source Beutler Lab
Gene Symbol Ccdc187
Ensembl Gene ENSMUSG00000048038
Gene Name coiled-coil domain containing 187
Synonyms 4932418E24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock # R8425 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 26243469-26294557 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 26281536 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 310 (V310D)
Ref Sequence ENSEMBL: ENSMUSP00000054283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057224] [ENSMUST00000217256] [ENSMUST00000227200]
AlphaFold Q8C5V8
Predicted Effect probably damaging
Transcript: ENSMUST00000057224
AA Change: V310D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054283
Gene: ENSMUSG00000048038
AA Change: V310D

DomainStartEndE-ValueType
low complexity region 116 132 N/A INTRINSIC
low complexity region 536 557 N/A INTRINSIC
coiled coil region 605 632 N/A INTRINSIC
coiled coil region 717 745 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000217256
AA Change: V310D
Predicted Effect unknown
Transcript: ENSMUST00000227200
AA Change: V349D
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik T C 6: 124,347,786 E92G possibly damaging Het
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Aasdh A T 5: 76,886,277 Y476N possibly damaging Het
Abca13 G T 11: 9,314,623 V3002F possibly damaging Het
Adam23 C T 1: 63,585,377 T788I probably damaging Het
Adgrb2 A G 4: 130,005,057 T282A possibly damaging Het
Adgrg1 T C 8: 95,008,407 Y402H probably damaging Het
Agpat2 A T 2: 26,593,654 L257Q probably benign Het
Agpat3 A T 10: 78,282,377 V255E possibly damaging Het
Akap6 A G 12: 52,886,621 I299V probably benign Het
Anapc1 A T 2: 128,669,868 F468L probably damaging Het
Apob T A 12: 7,988,842 N431K possibly damaging Het
Asprv1 T A 6: 86,628,869 D232E probably benign Het
AW209491 A G 13: 14,637,336 Y258C probably damaging Het
Bach2 C T 4: 32,562,316 P261L probably benign Het
Cap2 T A 13: 46,609,732 I146K probably damaging Het
Catsperb A T 12: 101,602,769 Q900L probably benign Het
Cenpe G T 3: 135,242,627 G1275* probably null Het
Chd8 C T 14: 52,210,555 G1663D probably damaging Het
Col6a5 T A 9: 105,945,957 Y67F unknown Het
Cuzd1 G T 7: 131,317,991 T132K possibly damaging Het
Ddr2 T A 1: 170,036,016 probably benign Het
Ddx42 T C 11: 106,247,724 I783T probably benign Het
Dennd4a T A 9: 64,838,974 D47E probably damaging Het
Dirc2 A T 16: 35,735,597 N164K probably benign Het
Dvl2 T G 11: 70,007,847 W379G probably damaging Het
Ehbp1 A G 11: 22,013,495 L1160P probably damaging Het
Eml6 A G 11: 29,755,008 V1512A probably benign Het
Ephb6 T C 6: 41,618,646 S780P probably damaging Het
Exo5 G A 4: 120,922,363 L102F probably benign Het
Fam220a A T 5: 143,562,839 K2M possibly damaging Het
Fanci A T 7: 79,433,541 I731L probably benign Het
Gbp8 A G 5: 105,017,774 S338P probably damaging Het
H2-M11 T C 17: 36,548,757 I214T probably benign Het
Hhatl C A 9: 121,789,102 A196S probably benign Het
Hspg2 C A 4: 137,550,867 C2988* probably null Het
Ifi213 A G 1: 173,589,860 S329P probably benign Het
Lingo3 G T 10: 80,834,982 F371L probably benign Het
Maml2 C T 9: 13,620,117 T209I Het
Ndufaf3 T C 9: 108,566,983 probably benign Het
Nfatc2 C T 2: 168,536,296 G483E probably damaging Het
Npy6r A C 18: 44,276,003 T164P probably benign Het
Olfr117 T A 17: 37,660,084 N83I probably damaging Het
Olfr1221 T A 2: 89,112,393 N40Y probably damaging Het
Olfr132 T C 17: 38,131,036 D52G possibly damaging Het
Olfr1502 T C 19: 13,862,485 S231P probably benign Het
Olfr173 A G 16: 58,797,603 M81T probably benign Het
Olfr659 A G 7: 104,671,295 N198D probably damaging Het
Omg T C 11: 79,502,000 E344G possibly damaging Het
P2rx7 A G 5: 122,670,458 E301G probably damaging Het
Pkhd1l1 T C 15: 44,574,515 S3569P probably benign Het
Pkn3 G A 2: 30,086,501 probably null Het
Proc C T 18: 32,123,358 V419M probably damaging Het
Prss37 C T 6: 40,516,118 W138* probably null Het
Prss52 T A 14: 64,112,560 L212* probably null Het
Rnps1 A G 17: 24,418,169 K8E unknown Het
Rpf2 A T 10: 40,225,433 L202* probably null Het
Saraf C T 8: 34,165,448 P227L probably benign Het
Serpinb5 T A 1: 106,881,785 M307K possibly damaging Het
Slc46a1 T C 11: 78,468,645 S368P possibly damaging Het
Slfn8 T A 11: 83,004,615 Q455L possibly damaging Het
Sv2b A G 7: 75,117,599 M683T probably damaging Het
Tacc3 G T 5: 33,664,530 L211F unknown Het
Tbc1d8 A G 1: 39,381,409 V681A probably damaging Het
Tbkbp1 T C 11: 97,138,851 E493G unknown Het
Th A T 7: 142,894,086 V420E possibly damaging Het
Tmem132c T G 5: 127,564,357 V115G Het
Usp40 G A 1: 87,959,836 R915C probably benign Het
Wdr81 T A 11: 75,451,522 H973L possibly damaging Het
Zdhhc6 A G 19: 55,314,444 S42P probably benign Het
Zfp369 T A 13: 65,296,675 I544N possibly damaging Het
Other mutations in Ccdc187
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Ccdc187 APN 2 26280948 missense probably benign
IGL02989:Ccdc187 APN 2 26276431 missense possibly damaging 0.92
IGL03017:Ccdc187 APN 2 26280966 missense probably benign
IGL03059:Ccdc187 APN 2 26294241 missense probably null 1.00
IGL03117:Ccdc187 APN 2 26287968 missense possibly damaging 0.95
R0026:Ccdc187 UTSW 2 26281353 missense probably benign 0.00
R0144:Ccdc187 UTSW 2 26276203 missense probably damaging 0.98
R1078:Ccdc187 UTSW 2 26294377 missense probably damaging 0.98
R1226:Ccdc187 UTSW 2 26276121 missense probably damaging 0.99
R1624:Ccdc187 UTSW 2 26281075 missense probably benign
R1733:Ccdc187 UTSW 2 26293658 missense possibly damaging 0.93
R1851:Ccdc187 UTSW 2 26276068 missense probably benign 0.17
R2304:Ccdc187 UTSW 2 26281017 missense possibly damaging 0.94
R4278:Ccdc187 UTSW 2 26282227 intron probably benign
R4344:Ccdc187 UTSW 2 26280669 missense probably damaging 1.00
R5151:Ccdc187 UTSW 2 26293439 missense probably damaging 1.00
R5416:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5537:Ccdc187 UTSW 2 26276225 missense probably benign 0.32
R5761:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5762:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5865:Ccdc187 UTSW 2 26293368 missense probably benign 0.00
R5925:Ccdc187 UTSW 2 26293581 missense probably benign
R6261:Ccdc187 UTSW 2 26276203 missense probably damaging 0.98
R6803:Ccdc187 UTSW 2 26289779 missense probably benign 0.02
R6888:Ccdc187 UTSW 2 26289734 missense probably damaging 0.98
R6958:Ccdc187 UTSW 2 26289719 missense probably benign
R7006:Ccdc187 UTSW 2 26281090 missense probably benign 0.05
R7358:Ccdc187 UTSW 2 26255995 missense probably damaging 0.97
R7818:Ccdc187 UTSW 2 26276174 missense possibly damaging 0.61
R8048:Ccdc187 UTSW 2 26293514 missense possibly damaging 0.53
R8327:Ccdc187 UTSW 2 26280618 missense probably benign 0.01
R8353:Ccdc187 UTSW 2 26276446 missense probably damaging 0.99
R8453:Ccdc187 UTSW 2 26276446 missense probably damaging 0.99
R8461:Ccdc187 UTSW 2 26293802 missense probably damaging 0.99
R8534:Ccdc187 UTSW 2 26275565 missense possibly damaging 0.61
R8694:Ccdc187 UTSW 2 26275493 missense probably benign 0.02
R8745:Ccdc187 UTSW 2 26280514 missense probably damaging 0.99
R8958:Ccdc187 UTSW 2 26275565 missense probably benign 0.02
R8972:Ccdc187 UTSW 2 26281067 missense probably benign
R9214:Ccdc187 UTSW 2 26293397 missense probably benign 0.19
R9454:Ccdc187 UTSW 2 26276102 missense possibly damaging 0.94
Z1176:Ccdc187 UTSW 2 26281507 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCTTTGAGGAGCCCTGCATG -3'
(R):5'- CCCATGTTGTCTCCTGAATGG -3'

Sequencing Primer
(F):5'- GTGCTTTGGAGTCCCCGATC -3'
(R):5'- TCCTGAATGGAGGAACAGGTCTG -3'
Posted On 2020-10-20