Incidental Mutation 'R8425:Cenpe'
ID 653395
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Name centromere protein E
Synonyms 312kDa, CENP-E, Kif10, N-7 kinesin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8425 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 135212537-135273611 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 135242627 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Stop codon at position 1275 (G1275*)
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893] [ENSMUST00000197369]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000062893
AA Change: G1275*
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: G1275*

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197369
SMART Domains Protein: ENSMUSP00000143435
Gene: ENSMUSG00000045328

DomainStartEndE-ValueType
coiled coil region 2 49 N/A INTRINSIC
coiled coil region 85 172 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik T C 6: 124,347,786 E92G possibly damaging Het
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Aasdh A T 5: 76,886,277 Y476N possibly damaging Het
Abca13 G T 11: 9,314,623 V3002F possibly damaging Het
Adam23 C T 1: 63,585,377 T788I probably damaging Het
Adgrb2 A G 4: 130,005,057 T282A possibly damaging Het
Adgrg1 T C 8: 95,008,407 Y402H probably damaging Het
Agpat2 A T 2: 26,593,654 L257Q probably benign Het
Agpat3 A T 10: 78,282,377 V255E possibly damaging Het
Akap6 A G 12: 52,886,621 I299V probably benign Het
Anapc1 A T 2: 128,669,868 F468L probably damaging Het
Apob T A 12: 7,988,842 N431K possibly damaging Het
Asprv1 T A 6: 86,628,869 D232E probably benign Het
AW209491 A G 13: 14,637,336 Y258C probably damaging Het
Bach2 C T 4: 32,562,316 P261L probably benign Het
Cap2 T A 13: 46,609,732 I146K probably damaging Het
Catsperb A T 12: 101,602,769 Q900L probably benign Het
Ccdc187 A T 2: 26,281,536 V310D probably damaging Het
Chd8 C T 14: 52,210,555 G1663D probably damaging Het
Col6a5 T A 9: 105,945,957 Y67F unknown Het
Cuzd1 G T 7: 131,317,991 T132K possibly damaging Het
Ddr2 T A 1: 170,036,016 probably benign Het
Ddx42 T C 11: 106,247,724 I783T probably benign Het
Dennd4a T A 9: 64,838,974 D47E probably damaging Het
Dirc2 A T 16: 35,735,597 N164K probably benign Het
Dvl2 T G 11: 70,007,847 W379G probably damaging Het
Ehbp1 A G 11: 22,013,495 L1160P probably damaging Het
Eml6 A G 11: 29,755,008 V1512A probably benign Het
Ephb6 T C 6: 41,618,646 S780P probably damaging Het
Exo5 G A 4: 120,922,363 L102F probably benign Het
Fam220a A T 5: 143,562,839 K2M possibly damaging Het
Fanci A T 7: 79,433,541 I731L probably benign Het
Gbp8 A G 5: 105,017,774 S338P probably damaging Het
H2-M11 T C 17: 36,548,757 I214T probably benign Het
Hhatl C A 9: 121,789,102 A196S probably benign Het
Hspg2 C A 4: 137,550,867 C2988* probably null Het
Ifi213 A G 1: 173,589,860 S329P probably benign Het
Lingo3 G T 10: 80,834,982 F371L probably benign Het
Maml2 C T 9: 13,620,117 T209I Het
Ndufaf3 T C 9: 108,566,983 probably benign Het
Nfatc2 C T 2: 168,536,296 G483E probably damaging Het
Npy6r A C 18: 44,276,003 T164P probably benign Het
Olfr117 T A 17: 37,660,084 N83I probably damaging Het
Olfr1221 T A 2: 89,112,393 N40Y probably damaging Het
Olfr132 T C 17: 38,131,036 D52G possibly damaging Het
Olfr1502 T C 19: 13,862,485 S231P probably benign Het
Olfr173 A G 16: 58,797,603 M81T probably benign Het
Olfr659 A G 7: 104,671,295 N198D probably damaging Het
Omg T C 11: 79,502,000 E344G possibly damaging Het
P2rx7 A G 5: 122,670,458 E301G probably damaging Het
Pkhd1l1 T C 15: 44,574,515 S3569P probably benign Het
Pkn3 G A 2: 30,086,501 probably null Het
Proc C T 18: 32,123,358 V419M probably damaging Het
Prss37 C T 6: 40,516,118 W138* probably null Het
Prss52 T A 14: 64,112,560 L212* probably null Het
Rnps1 A G 17: 24,418,169 K8E unknown Het
Rpf2 A T 10: 40,225,433 L202* probably null Het
Saraf C T 8: 34,165,448 P227L probably benign Het
Serpinb5 T A 1: 106,881,785 M307K possibly damaging Het
Slc46a1 T C 11: 78,468,645 S368P possibly damaging Het
Slfn8 T A 11: 83,004,615 Q455L possibly damaging Het
Sv2b A G 7: 75,117,599 M683T probably damaging Het
Tacc3 G T 5: 33,664,530 L211F unknown Het
Tbc1d8 A G 1: 39,381,409 V681A probably damaging Het
Tbkbp1 T C 11: 97,138,851 E493G unknown Het
Th A T 7: 142,894,086 V420E possibly damaging Het
Tmem132c T G 5: 127,564,357 V115G Het
Usp40 G A 1: 87,959,836 R915C probably benign Het
Wdr81 T A 11: 75,451,522 H973L possibly damaging Het
Zdhhc6 A G 19: 55,314,444 S42P probably benign Het
Zfp369 T A 13: 65,296,675 I544N possibly damaging Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 135231455 critical splice donor site probably null
IGL00799:Cenpe APN 3 135228917 critical splice donor site probably null
IGL00815:Cenpe APN 3 135259351 missense probably benign
IGL01446:Cenpe APN 3 135237539 missense probably benign 0.01
IGL01469:Cenpe APN 3 135228806 missense probably damaging 1.00
IGL01843:Cenpe APN 3 135218507 missense possibly damaging 0.88
IGL02254:Cenpe APN 3 135255477 missense probably benign
IGL02337:Cenpe APN 3 135220276 splice site probably benign
IGL02382:Cenpe APN 3 135247386 missense probably benign
IGL02458:Cenpe APN 3 135230108 nonsense probably null
IGL02934:Cenpe APN 3 135264351 missense probably damaging 1.00
IGL03335:Cenpe APN 3 135243625 missense probably benign
R0086:Cenpe UTSW 3 135264424 splice site probably benign
R0173:Cenpe UTSW 3 135259983 missense probably benign 0.00
R0394:Cenpe UTSW 3 135216425 splice site probably benign
R0411:Cenpe UTSW 3 135222255 missense probably damaging 1.00
R0624:Cenpe UTSW 3 135246586 missense probably benign 0.00
R0634:Cenpe UTSW 3 135246827 missense probably damaging 1.00
R0648:Cenpe UTSW 3 135230082 missense probably damaging 1.00
R0691:Cenpe UTSW 3 135217305 missense probably damaging 1.00
R1184:Cenpe UTSW 3 135264422 critical splice donor site probably null
R1530:Cenpe UTSW 3 135246902 missense possibly damaging 0.92
R1559:Cenpe UTSW 3 135270900 missense probably benign 0.07
R1562:Cenpe UTSW 3 135238394 missense possibly damaging 0.53
R1568:Cenpe UTSW 3 135239758 missense probably benign 0.01
R1712:Cenpe UTSW 3 135265933 missense probably damaging 0.99
R1828:Cenpe UTSW 3 135246496 missense probably damaging 0.99
R1846:Cenpe UTSW 3 135239845 missense probably damaging 1.00
R1861:Cenpe UTSW 3 135268979 missense probably damaging 1.00
R1938:Cenpe UTSW 3 135247479 missense probably damaging 0.98
R1961:Cenpe UTSW 3 135242493 missense probably damaging 1.00
R2062:Cenpe UTSW 3 135222321 splice site probably benign
R2118:Cenpe UTSW 3 135246884 missense possibly damaging 0.94
R2127:Cenpe UTSW 3 135239780 missense probably benign 0.08
R2156:Cenpe UTSW 3 135247474 missense probably benign 0.34
R2265:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2268:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2392:Cenpe UTSW 3 135248113 missense probably damaging 1.00
R2508:Cenpe UTSW 3 135241073 missense possibly damaging 0.92
R3084:Cenpe UTSW 3 135241021 missense probably damaging 1.00
R3779:Cenpe UTSW 3 135256576 missense possibly damaging 0.87
R3833:Cenpe UTSW 3 135222322 splice site probably benign
R3974:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135238472 critical splice donor site probably null
R4151:Cenpe UTSW 3 135215153 missense probably benign 0.36
R4166:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R4581:Cenpe UTSW 3 135247000 missense probably benign 0.30
R4622:Cenpe UTSW 3 135243708 missense probably benign 0.22
R4692:Cenpe UTSW 3 135216379 missense probably benign 0.29
R4769:Cenpe UTSW 3 135248151 missense probably benign
R4976:Cenpe UTSW 3 135234876 missense probably damaging 1.00
R4983:Cenpe UTSW 3 135234928 missense probably damaging 1.00
R4990:Cenpe UTSW 3 135256640 missense probably damaging 1.00
R5002:Cenpe UTSW 3 135247081 missense probably benign
R5057:Cenpe UTSW 3 135220313 missense probably benign 0.14
R5063:Cenpe UTSW 3 135270954 missense probably damaging 0.99
R5181:Cenpe UTSW 3 135242303 missense probably damaging 0.99
R5281:Cenpe UTSW 3 135230150 missense possibly damaging 0.89
R5389:Cenpe UTSW 3 135259388 critical splice donor site probably null
R5517:Cenpe UTSW 3 135223265 missense probably damaging 1.00
R5521:Cenpe UTSW 3 135269065 missense probably damaging 1.00
R5607:Cenpe UTSW 3 135235076 nonsense probably null
R5608:Cenpe UTSW 3 135235076 nonsense probably null
R5627:Cenpe UTSW 3 135235473 missense possibly damaging 0.51
R5766:Cenpe UTSW 3 135248413 missense probably damaging 0.96
R5783:Cenpe UTSW 3 135261580 missense probably benign 0.00
R5933:Cenpe UTSW 3 135261628 missense probably benign 0.03
R6073:Cenpe UTSW 3 135260073 nonsense probably null
R6163:Cenpe UTSW 3 135269003 missense probably damaging 0.99
R6192:Cenpe UTSW 3 135248530 missense possibly damaging 0.93
R6224:Cenpe UTSW 3 135243775 missense possibly damaging 0.87
R6313:Cenpe UTSW 3 135230175 missense probably benign 0.26
R6326:Cenpe UTSW 3 135239778 missense probably benign 0.15
R6383:Cenpe UTSW 3 135251528 missense probably damaging 1.00
R6418:Cenpe UTSW 3 135251544 missense probably damaging 0.99
R6797:Cenpe UTSW 3 135238138 missense possibly damaging 0.92
R6810:Cenpe UTSW 3 135243822 missense probably benign 0.00
R6989:Cenpe UTSW 3 135235127 missense probably damaging 1.00
R7009:Cenpe UTSW 3 135235201 missense probably damaging 0.97
R7009:Cenpe UTSW 3 135235202 missense probably benign 0.02
R7039:Cenpe UTSW 3 135255456 missense probably benign 0.28
R7387:Cenpe UTSW 3 135247037 missense probably benign 0.05
R7470:Cenpe UTSW 3 135242155 missense probably damaging 1.00
R7535:Cenpe UTSW 3 135243762 missense possibly damaging 0.90
R7562:Cenpe UTSW 3 135248634 missense probably damaging 1.00
R7573:Cenpe UTSW 3 135247459 missense probably damaging 1.00
R7613:Cenpe UTSW 3 135242302 missense possibly damaging 0.90
R7741:Cenpe UTSW 3 135247335 splice site probably null
R7771:Cenpe UTSW 3 135240941 splice site probably null
R7843:Cenpe UTSW 3 135232959 nonsense probably null
R7973:Cenpe UTSW 3 135223250 missense probably damaging 1.00
R8036:Cenpe UTSW 3 135239848 frame shift probably null
R8069:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R8151:Cenpe UTSW 3 135247022 missense probably benign 0.28
R8176:Cenpe UTSW 3 135230090 missense probably damaging 1.00
R8191:Cenpe UTSW 3 135251614 missense probably benign
R8251:Cenpe UTSW 3 135251684 critical splice donor site probably null
R8488:Cenpe UTSW 3 135259241 missense probably damaging 1.00
R8811:Cenpe UTSW 3 135223240 missense probably damaging 1.00
R8850:Cenpe UTSW 3 135225016 missense probably damaging 1.00
R8879:Cenpe UTSW 3 135260101 missense probably damaging 0.99
R8899:Cenpe UTSW 3 135239883 missense probably benign 0.18
R9035:Cenpe UTSW 3 135270811 missense probably benign 0.01
R9038:Cenpe UTSW 3 135218036 missense probably benign 0.00
R9093:Cenpe UTSW 3 135239880 nonsense probably null
R9221:Cenpe UTSW 3 135230078 missense possibly damaging 0.90
R9365:Cenpe UTSW 3 135248446 missense possibly damaging 0.56
R9443:Cenpe UTSW 3 135270848 missense probably damaging 0.99
Z1177:Cenpe UTSW 3 135216385 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TTCACTTACTGAACAAGGGCC -3'
(R):5'- AACCAATATGGGTCTTTCTTTGTCC -3'

Sequencing Primer
(F):5'- TTACTGAACAAGGGCCTACAAAC -3'
(R):5'- CGAGCCTCAAACTTTCTGTGGAG -3'
Posted On 2020-10-20