Incidental Mutation 'R8425:Aasdh'
ID653401
Institutional Source Beutler Lab
Gene Symbol Aasdh
Ensembl Gene ENSMUSG00000055923
Gene Nameaminoadipate-semialdehyde dehydrogenase
SynonymsA230062G08Rik
MMRRC Submission
Accession Numbers

Genbank: NM_173765.3; Ensembl: ENSMUST00000120963

Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R8425 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location76873659-76905514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76886277 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 476 (Y476N)
Ref Sequence ENSEMBL: ENSMUSP00000113792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069709] [ENSMUST00000120963] [ENSMUST00000123682] [ENSMUST00000126741] [ENSMUST00000146570] [ENSMUST00000149602]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069709
AA Change: Y476N

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000069279
Gene: ENSMUSG00000055923
AA Change: Y476N

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000120963
AA Change: Y476N

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113792
Gene: ENSMUSG00000055923
AA Change: Y476N

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123682
SMART Domains Protein: ENSMUSP00000121050
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 231 1.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126741
SMART Domains Protein: ENSMUSP00000118854
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 403 7.5e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000146570
AA Change: Y476N

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117639
Gene: ENSMUSG00000055923
AA Change: Y476N

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 2.1e-58 PFAM
Pfam:PP-binding 556 628 1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149602
SMART Domains Protein: ENSMUSP00000117489
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
PQQ 21 53 4.37e-2 SMART
PQQ 63 95 2.3e1 SMART
Blast:PQQ 104 130 2e-6 BLAST
PQQ 141 173 2.61e2 SMART
low complexity region 191 200 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: The gene product is a cytosolic enzyme involved in the production of alpha-aminoadipic acid from alpha-aminoadipic semialdehyde. It is postulated that this enzyme plays a role in lysine metabolism. There is currently debate regarding this enzyme's putative requirement of pyrroloquinoline quinine as an essential cofactor. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik T C 6: 124,347,786 E92G possibly damaging Het
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Abca13 G T 11: 9,314,623 V3002F possibly damaging Het
Adam23 C T 1: 63,585,377 T788I probably damaging Het
Adgrb2 A G 4: 130,005,057 T282A possibly damaging Het
Adgrg1 T C 8: 95,008,407 Y402H probably damaging Het
Agpat2 A T 2: 26,593,654 L257Q probably benign Het
Agpat3 A T 10: 78,282,377 V255E possibly damaging Het
Akap6 A G 12: 52,886,621 I299V probably benign Het
Anapc1 A T 2: 128,669,868 F468L probably damaging Het
Apob T A 12: 7,988,842 N431K possibly damaging Het
Asprv1 T A 6: 86,628,869 D232E probably benign Het
AW209491 A G 13: 14,637,336 Y258C probably damaging Het
Bach2 C T 4: 32,562,316 P261L probably benign Het
Cap2 T A 13: 46,609,732 I146K probably damaging Het
Catsperb A T 12: 101,602,769 Q900L probably benign Het
Ccdc187 A T 2: 26,281,536 V310D probably damaging Het
Cenpe G T 3: 135,242,627 G1275* probably null Het
Chd8 C T 14: 52,210,555 G1663D probably damaging Het
Col6a5 T A 9: 105,945,957 Y67F unknown Het
Cuzd1 G T 7: 131,317,991 T132K possibly damaging Het
Ddr2 T A 1: 170,036,016 probably benign Het
Ddx42 T C 11: 106,247,724 I783T probably benign Het
Dennd4a T A 9: 64,838,974 D47E probably damaging Het
Dirc2 A T 16: 35,735,597 N164K probably benign Het
Dvl2 T G 11: 70,007,847 W379G probably damaging Het
Ehbp1 A G 11: 22,013,495 L1160P probably damaging Het
Eml6 A G 11: 29,755,008 V1512A probably benign Het
Ephb6 T C 6: 41,618,646 S780P probably damaging Het
Exo5 G A 4: 120,922,363 L102F probably benign Het
Fam220a A T 5: 143,562,839 K2M possibly damaging Het
Fanci A T 7: 79,433,541 I731L probably benign Het
Gbp8 A G 5: 105,017,774 S338P probably damaging Het
H2-M11 T C 17: 36,548,757 I214T probably benign Het
Hhatl C A 9: 121,789,102 A196S probably benign Het
Hspg2 C A 4: 137,550,867 C2988* probably null Het
Ifi213 A G 1: 173,589,860 S329P probably benign Het
Lingo3 G T 10: 80,834,982 F371L probably benign Het
Maml2 C T 9: 13,620,117 T209I Het
Ndufaf3 T C 9: 108,566,983 probably benign Het
Nfatc2 C T 2: 168,536,296 G483E probably damaging Het
Npy6r A C 18: 44,276,003 T164P probably benign Het
Olfr117 T A 17: 37,660,084 N83I probably damaging Het
Olfr1221 T A 2: 89,112,393 N40Y probably damaging Het
Olfr132 T C 17: 38,131,036 D52G possibly damaging Het
Olfr1502 T C 19: 13,862,485 S231P probably benign Het
Olfr173 A G 16: 58,797,603 M81T probably benign Het
Olfr659 A G 7: 104,671,295 N198D probably damaging Het
Omg T C 11: 79,502,000 E344G possibly damaging Het
P2rx7 A G 5: 122,670,458 E301G probably damaging Het
Pkhd1l1 T C 15: 44,574,515 S3569P probably benign Het
Pkn3 G A 2: 30,086,501 probably null Het
Proc C T 18: 32,123,358 V419M probably damaging Het
Prss37 C T 6: 40,516,118 W138* probably null Het
Prss52 T A 14: 64,112,560 L212* probably null Het
Rnps1 A G 17: 24,418,169 K8E unknown Het
Rpf2 A T 10: 40,225,433 L202* probably null Het
Saraf C T 8: 34,165,448 P227L probably benign Het
Serpinb5 T A 1: 106,881,785 M307K possibly damaging Het
Slc46a1 T C 11: 78,468,645 S368P possibly damaging Het
Slfn8 T A 11: 83,004,615 Q455L possibly damaging Het
Sv2b A G 7: 75,117,599 M683T probably damaging Het
Tacc3 G T 5: 33,664,530 L211F unknown Het
Tbc1d8 A G 1: 39,381,409 V681A probably damaging Het
Tbkbp1 T C 11: 97,138,851 E493G unknown Het
Th A T 7: 142,894,086 V420E possibly damaging Het
Tmem132c T G 5: 127,564,357 V115G Het
Usp40 G A 1: 87,959,836 R915C probably benign Het
Wdr81 T A 11: 75,451,522 H973L possibly damaging Het
Zdhhc6 A G 19: 55,314,444 S42P probably benign Het
Zfp369 T A 13: 65,296,675 I544N possibly damaging Het
Other mutations in Aasdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Aasdh APN 5 76878534 unclassified probably benign
IGL01013:Aasdh APN 5 76886206 missense possibly damaging 0.68
IGL01558:Aasdh APN 5 76888617 missense possibly damaging 0.89
IGL02544:Aasdh APN 5 76902114 missense probably benign 0.27
IGL02614:Aasdh APN 5 76896368 splice site probably benign
IGL02678:Aasdh APN 5 76888020 splice site probably benign
IGL02739:Aasdh APN 5 76878517 missense possibly damaging 0.64
IGL02947:Aasdh APN 5 76902110 missense probably benign 0.01
IGL03116:Aasdh APN 5 76902089 splice site probably null
IGL03398:Aasdh APN 5 76891719 missense probably benign 0.02
1mM(1):Aasdh UTSW 5 76896617 missense possibly damaging 0.91
R0183:Aasdh UTSW 5 76886235 missense probably benign 0.05
R0226:Aasdh UTSW 5 76902002 missense probably damaging 1.00
R0367:Aasdh UTSW 5 76902114 missense probably damaging 0.99
R0386:Aasdh UTSW 5 76896461 missense probably damaging 0.98
R0529:Aasdh UTSW 5 76876267 nonsense probably null
R0881:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R0882:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1033:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1034:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1035:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1036:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1366:Aasdh UTSW 5 76888804 missense probably benign 0.10
R1446:Aasdh UTSW 5 76886289 missense probably benign 0.45
R1449:Aasdh UTSW 5 76886289 missense probably benign 0.45
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1583:Aasdh UTSW 5 76882681 missense probably benign 0.00
R1641:Aasdh UTSW 5 76891779 missense probably benign 0.36
R1876:Aasdh UTSW 5 76877549 missense probably damaging 1.00
R1895:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R1946:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R3615:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3616:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3746:Aasdh UTSW 5 76888654 nonsense probably null
R3747:Aasdh UTSW 5 76888654 nonsense probably null
R3748:Aasdh UTSW 5 76888654 nonsense probably null
R3750:Aasdh UTSW 5 76888654 nonsense probably null
R3836:Aasdh UTSW 5 76878468 missense probably benign 0.32
R4857:Aasdh UTSW 5 76887284 missense probably benign 0.01
R4928:Aasdh UTSW 5 76896688 missense possibly damaging 0.65
R4937:Aasdh UTSW 5 76888654 nonsense probably null
R5762:Aasdh UTSW 5 76896598 missense probably benign 0.00
R5866:Aasdh UTSW 5 76876211 missense probably damaging 1.00
R5940:Aasdh UTSW 5 76882898 missense probably benign 0.07
R6253:Aasdh UTSW 5 76886258 missense possibly damaging 0.81
R6542:Aasdh UTSW 5 76883055 missense probably damaging 1.00
R6825:Aasdh UTSW 5 76888849 splice site probably null
R6868:Aasdh UTSW 5 76891680 missense probably damaging 0.99
R6876:Aasdh UTSW 5 76896441 missense probably damaging 1.00
R6961:Aasdh UTSW 5 76876301 missense probably damaging 1.00
R6963:Aasdh UTSW 5 76896456 missense probably damaging 0.99
R7069:Aasdh UTSW 5 76876356 missense probably benign 0.03
R7220:Aasdh UTSW 5 76901925 missense probably benign 0.13
R7545:Aasdh UTSW 5 76880014 missense probably damaging 1.00
R7673:Aasdh UTSW 5 76882708 missense probably benign 0.03
R7703:Aasdh UTSW 5 76888077 missense probably damaging 0.99
R7890:Aasdh UTSW 5 76884122 missense probably benign 0.19
R7978:Aasdh UTSW 5 76888668 missense probably damaging 0.99
R8046:Aasdh UTSW 5 76896478 missense probably benign
R8152:Aasdh UTSW 5 76896458 missense probably damaging 1.00
R8884:Aasdh UTSW 5 76891794 missense possibly damaging 0.94
R9028:Aasdh UTSW 5 76876130 missense probably damaging 1.00
Z1088:Aasdh UTSW 5 76901157 splice site probably null
Z1176:Aasdh UTSW 5 76891796 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TAGTCCTTCTGCAGCCATTGAC -3'
(R):5'- GCTTTAGCGTTAATTATGGTAGACC -3'

Sequencing Primer
(F):5'- TTCTGCAGCCATTGACCAACG -3'
(R):5'- TGGTAGACCCTTGTAACTTTATCAG -3'
Posted On2020-10-20