Incidental Mutation 'R8425:Fanci'
ID653411
Institutional Source Beutler Lab
Gene Symbol Fanci
Ensembl Gene ENSMUSG00000039187
Gene NameFanconi anemia, complementation group I
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.709) question?
Stock #R8425 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location79391929-79450264 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79433541 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 731 (I731L)
Ref Sequence ENSEMBL: ENSMUSP00000117992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036865] [ENSMUST00000132091] [ENSMUST00000137667]
Predicted Effect probably benign
Transcript: ENSMUST00000036865
AA Change: I759L

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000044931
Gene: ENSMUSG00000039187
AA Change: I759L

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 7.5e-27 PFAM
Pfam:FANCI_S1 62 280 3.5e-78 PFAM
Pfam:FANCI_HD1 284 370 1.6e-37 PFAM
Pfam:FANCI_S2 378 540 2.4e-63 PFAM
Pfam:FANCI_HD2 554 785 4.8e-87 PFAM
Pfam:FANCI_S3 803 1028 1.7e-83 PFAM
Pfam:FANCI_S4 1041 1295 1.3e-95 PFAM
low complexity region 1299 1307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132091
SMART Domains Protein: ENSMUSP00000122113
Gene: ENSMUSG00000039187

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 1.6e-29 PFAM
Pfam:FANCI_S1 60 281 3.2e-81 PFAM
Pfam:FANCI_HD1 284 371 2.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137667
AA Change: I731L

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117992
Gene: ENSMUSG00000039187
AA Change: I731L

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 25 7.2e-11 PFAM
Pfam:FANCI_S1 32 253 3.4e-80 PFAM
Pfam:FANCI_HD1 256 343 7.3e-37 PFAM
Pfam:FANCI_S2 349 513 8.5e-56 PFAM
Pfam:FANCI_HD2 523 758 9.3e-99 PFAM
Pfam:FANCI_S3 775 850 1.3e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group I. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik T C 6: 124,347,786 E92G possibly damaging Het
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Aasdh A T 5: 76,886,277 Y476N possibly damaging Het
Abca13 G T 11: 9,314,623 V3002F possibly damaging Het
Adam23 C T 1: 63,585,377 T788I probably damaging Het
Adgrb2 A G 4: 130,005,057 T282A possibly damaging Het
Adgrg1 T C 8: 95,008,407 Y402H probably damaging Het
Agpat2 A T 2: 26,593,654 L257Q probably benign Het
Agpat3 A T 10: 78,282,377 V255E possibly damaging Het
Akap6 A G 12: 52,886,621 I299V probably benign Het
Anapc1 A T 2: 128,669,868 F468L probably damaging Het
Apob T A 12: 7,988,842 N431K possibly damaging Het
Asprv1 T A 6: 86,628,869 D232E probably benign Het
AW209491 A G 13: 14,637,336 Y258C probably damaging Het
Bach2 C T 4: 32,562,316 P261L probably benign Het
Cap2 T A 13: 46,609,732 I146K probably damaging Het
Catsperb A T 12: 101,602,769 Q900L probably benign Het
Ccdc187 A T 2: 26,281,536 V310D probably damaging Het
Cenpe G T 3: 135,242,627 G1275* probably null Het
Chd8 C T 14: 52,210,555 G1663D probably damaging Het
Col6a5 T A 9: 105,945,957 Y67F unknown Het
Cuzd1 G T 7: 131,317,991 T132K possibly damaging Het
Ddr2 T A 1: 170,036,016 probably benign Het
Ddx42 T C 11: 106,247,724 I783T probably benign Het
Dennd4a T A 9: 64,838,974 D47E probably damaging Het
Dirc2 A T 16: 35,735,597 N164K probably benign Het
Dvl2 T G 11: 70,007,847 W379G probably damaging Het
Ehbp1 A G 11: 22,013,495 L1160P probably damaging Het
Eml6 A G 11: 29,755,008 V1512A probably benign Het
Ephb6 T C 6: 41,618,646 S780P probably damaging Het
Exo5 G A 4: 120,922,363 L102F probably benign Het
Fam220a A T 5: 143,562,839 K2M possibly damaging Het
Gbp8 A G 5: 105,017,774 S338P probably damaging Het
H2-M11 T C 17: 36,548,757 I214T probably benign Het
Hhatl C A 9: 121,789,102 A196S probably benign Het
Hspg2 C A 4: 137,550,867 C2988* probably null Het
Ifi213 A G 1: 173,589,860 S329P probably benign Het
Lingo3 G T 10: 80,834,982 F371L probably benign Het
Maml2 C T 9: 13,620,117 T209I Het
Ndufaf3 T C 9: 108,566,983 probably benign Het
Nfatc2 C T 2: 168,536,296 G483E probably damaging Het
Npy6r A C 18: 44,276,003 T164P probably benign Het
Olfr117 T A 17: 37,660,084 N83I probably damaging Het
Olfr1221 T A 2: 89,112,393 N40Y probably damaging Het
Olfr132 T C 17: 38,131,036 D52G possibly damaging Het
Olfr1502 T C 19: 13,862,485 S231P probably benign Het
Olfr173 A G 16: 58,797,603 M81T probably benign Het
Olfr659 A G 7: 104,671,295 N198D probably damaging Het
Omg T C 11: 79,502,000 E344G possibly damaging Het
P2rx7 A G 5: 122,670,458 E301G probably damaging Het
Pkhd1l1 T C 15: 44,574,515 S3569P probably benign Het
Pkn3 G A 2: 30,086,501 probably null Het
Proc C T 18: 32,123,358 V419M probably damaging Het
Prss37 C T 6: 40,516,118 W138* probably null Het
Prss52 T A 14: 64,112,560 L212* probably null Het
Rnps1 A G 17: 24,418,169 K8E unknown Het
Rpf2 A T 10: 40,225,433 L202* probably null Het
Saraf C T 8: 34,165,448 P227L probably benign Het
Serpinb5 T A 1: 106,881,785 M307K possibly damaging Het
Slc46a1 T C 11: 78,468,645 S368P possibly damaging Het
Slfn8 T A 11: 83,004,615 Q455L possibly damaging Het
Sv2b A G 7: 75,117,599 M683T probably damaging Het
Tacc3 G T 5: 33,664,530 L211F unknown Het
Tbc1d8 A G 1: 39,381,409 V681A probably damaging Het
Tbkbp1 T C 11: 97,138,851 E493G unknown Het
Th A T 7: 142,894,086 V420E possibly damaging Het
Tmem132c T G 5: 127,564,357 V115G Het
Usp40 G A 1: 87,959,836 R915C probably benign Het
Wdr81 T A 11: 75,451,522 H973L possibly damaging Het
Zdhhc6 A G 19: 55,314,444 S42P probably benign Het
Zfp369 T A 13: 65,296,675 I544N possibly damaging Het
Other mutations in Fanci
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Fanci APN 7 79412700 missense probably damaging 1.00
IGL00718:Fanci APN 7 79444174 missense possibly damaging 0.92
IGL00764:Fanci APN 7 79395912 start codon destroyed probably null 0.05
IGL01669:Fanci APN 7 79449177 missense probably benign 0.01
IGL02338:Fanci APN 7 79433531 nonsense probably null
IGL02428:Fanci APN 7 79444516 intron probably benign
IGL03029:Fanci APN 7 79443999 missense probably benign 0.00
BB005:Fanci UTSW 7 79444711 missense probably benign
BB015:Fanci UTSW 7 79444711 missense probably benign
P0023:Fanci UTSW 7 79402300 missense probably benign 0.00
P0047:Fanci UTSW 7 79444044 missense probably damaging 1.00
R0310:Fanci UTSW 7 79407417 splice site probably benign
R0388:Fanci UTSW 7 79439630 missense probably benign
R0506:Fanci UTSW 7 79432178 missense probably benign 0.29
R0570:Fanci UTSW 7 79443963 missense probably damaging 1.00
R0631:Fanci UTSW 7 79406205 missense probably damaging 1.00
R0746:Fanci UTSW 7 79439681 missense probably damaging 0.99
R0981:Fanci UTSW 7 79405166 missense probably benign 0.01
R1559:Fanci UTSW 7 79433193 missense probably damaging 1.00
R1656:Fanci UTSW 7 79405188 splice site probably benign
R1748:Fanci UTSW 7 79430488 missense probably damaging 1.00
R1815:Fanci UTSW 7 79438308 missense probably damaging 1.00
R2164:Fanci UTSW 7 79395995 missense probably benign 0.22
R3508:Fanci UTSW 7 79433472 missense probably benign 0.01
R3908:Fanci UTSW 7 79433509 missense possibly damaging 0.91
R4036:Fanci UTSW 7 79444822 missense probably damaging 1.00
R4066:Fanci UTSW 7 79412757 critical splice donor site probably null
R4633:Fanci UTSW 7 79427242 missense probably damaging 1.00
R4651:Fanci UTSW 7 79435256 missense possibly damaging 0.74
R4993:Fanci UTSW 7 79435378 makesense probably null
R5341:Fanci UTSW 7 79406178 missense probably damaging 1.00
R5806:Fanci UTSW 7 79448848 missense probably damaging 0.97
R5898:Fanci UTSW 7 79433321 missense probably benign
R5919:Fanci UTSW 7 79444738 missense probably damaging 1.00
R5960:Fanci UTSW 7 79443762 missense probably damaging 1.00
R6367:Fanci UTSW 7 79426195 missense probably damaging 0.99
R6436:Fanci UTSW 7 79440698 missense probably benign 0.03
R6468:Fanci UTSW 7 79417939 missense probably benign 0.10
R6508:Fanci UTSW 7 79443768 missense probably damaging 0.99
R6886:Fanci UTSW 7 79420342 missense possibly damaging 0.81
R7554:Fanci UTSW 7 79412752 missense probably damaging 0.99
R7588:Fanci UTSW 7 79434269 missense possibly damaging 0.81
R7644:Fanci UTSW 7 79444471 nonsense probably null
R7697:Fanci UTSW 7 79406292 critical splice donor site probably null
R7732:Fanci UTSW 7 79412652 missense possibly damaging 0.65
R7928:Fanci UTSW 7 79444711 missense probably benign
R8170:Fanci UTSW 7 79433557 splice site probably null
R8355:Fanci UTSW 7 79435281 missense probably damaging 1.00
R8429:Fanci UTSW 7 79438385 missense possibly damaging 0.65
R8455:Fanci UTSW 7 79435281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTAAGTCCTCGGGCCTATG -3'
(R):5'- TTCACAGGTCTGGAGGGAAG -3'

Sequencing Primer
(F):5'- CCTATGGACCGATGGAAGCTTTG -3'
(R):5'- CAGGAAGATCTCTGGTCTACATG -3'
Posted On2020-10-20