Incidental Mutation 'R8426:Tmprss11c'
ID653471
Institutional Source Beutler Lab
Gene Symbol Tmprss11c
Ensembl Gene ENSMUSG00000061184
Gene Nametransmembrane protease, serine 11c
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8426 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location86231481-86289308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86231818 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 410 (N410K)
Ref Sequence ENSEMBL: ENSMUSP00000062915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059424] [ENSMUST00000196462]
Predicted Effect probably damaging
Transcript: ENSMUST00000059424
AA Change: N410K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062915
Gene: ENSMUSG00000061184
AA Change: N410K

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
SEA 58 183 5.19e-3 SMART
Tryp_SPc 199 425 8.42e-91 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000196462
AA Change: N397K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142902
Gene: ENSMUSG00000061184
AA Change: N397K

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
SEA 58 176 3.6e-4 SMART
Tryp_SPc 186 412 4.1e-93 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik G A 3: 108,471,426 A352V probably damaging Het
Abcb11 T C 2: 69,325,262 H32R probably benign Het
Abcb1b T C 5: 8,861,632 probably null Het
Aicda A T 6: 122,561,191 N103Y probably damaging Het
Bsn T C 9: 108,126,573 E211G probably damaging Het
Casp9 T C 4: 141,813,625 Y435H probably damaging Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ceacam5 T C 7: 17,759,341 V763A possibly damaging Het
Cxcr6 A G 9: 123,810,006 N31S probably benign Het
Gm17728 A G 17: 9,422,399 T114A probably benign Het
Gnao1 A T 8: 93,896,229 probably null Het
Iffo2 A T 4: 139,614,980 Y451F probably damaging Het
Ints4 G A 7: 97,501,032 W258* probably null Het
Ipo11 T C 13: 106,842,170 D834G possibly damaging Het
Kif5a T C 10: 127,231,489 D853G probably damaging Het
Lama4 A G 10: 39,103,491 E1655G probably damaging Het
Lepr G A 4: 101,814,644 S955N probably benign Het
Lrp1b T C 2: 41,498,306 I550V Het
Mov10l1 T A 15: 88,997,405 probably null Het
Mroh9 A T 1: 163,024,725 D798E probably damaging Het
Myo10 A G 15: 25,799,490 I1380V probably damaging Het
Neu2 C T 1: 87,596,665 S124L probably damaging Het
Nol6 T C 4: 41,119,870 I543V probably benign Het
Nrxn3 G A 12: 88,795,327 R48H possibly damaging Het
Ogn C T 13: 49,621,091 R237C possibly damaging Het
Olfr432 T C 1: 174,050,580 L69P probably damaging Het
Olfr910 A T 9: 38,539,324 Y143F probably damaging Het
Phf24 C T 4: 42,933,785 Q19* probably null Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ptch2 G T 4: 117,108,172 S318I possibly damaging Het
Sart1 A G 19: 5,383,741 M356T probably benign Het
Slit2 A G 5: 48,224,763 N529D probably benign Het
Smchd1 A C 17: 71,448,603 D261E probably damaging Het
Tcerg1 G A 18: 42,548,401 V538I possibly damaging Het
Thada A T 17: 84,222,703 M1746K probably benign Het
Thsd1 A G 8: 22,243,638 I234V probably benign Het
Tm9sf4 G A 2: 153,203,816 G536D probably damaging Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Unc5d G T 8: 28,719,988 S440Y probably damaging Het
Vmn1r44 A G 6: 89,893,488 D72G probably benign Het
Vmn1r68 T C 7: 10,527,455 N239D probably benign Het
Vmn2r107 T A 17: 20,356,977 H412Q possibly damaging Het
Other mutations in Tmprss11c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tmprss11c APN 5 86239395 missense probably benign 0.00
IGL01357:Tmprss11c APN 5 86231807 missense probably damaging 1.00
IGL01809:Tmprss11c APN 5 86237662 missense possibly damaging 0.89
IGL02972:Tmprss11c APN 5 86237833 missense possibly damaging 0.77
IGL03135:Tmprss11c APN 5 86237650 missense probably damaging 1.00
IGL03255:Tmprss11c APN 5 86271482 missense probably damaging 0.99
IGL03355:Tmprss11c APN 5 86231871 missense probably benign 0.03
R0165:Tmprss11c UTSW 5 86231927 splice site probably benign
R0285:Tmprss11c UTSW 5 86271430 missense probably damaging 1.00
R0480:Tmprss11c UTSW 5 86237609 splice site probably benign
R0639:Tmprss11c UTSW 5 86235469 missense probably damaging 1.00
R1554:Tmprss11c UTSW 5 86289260 start codon destroyed possibly damaging 0.59
R1651:Tmprss11c UTSW 5 86239424 missense probably damaging 1.00
R2234:Tmprss11c UTSW 5 86282086 missense probably benign 0.12
R2235:Tmprss11c UTSW 5 86282086 missense probably benign 0.12
R2698:Tmprss11c UTSW 5 86271463 missense probably damaging 1.00
R4787:Tmprss11c UTSW 5 86256453 missense probably benign 0.00
R4962:Tmprss11c UTSW 5 86237710 missense probably damaging 1.00
R5063:Tmprss11c UTSW 5 86237830 missense probably benign 0.28
R5217:Tmprss11c UTSW 5 86256390 missense probably benign
R5366:Tmprss11c UTSW 5 86282134 missense possibly damaging 0.93
R6343:Tmprss11c UTSW 5 86256345 missense probably damaging 1.00
R6598:Tmprss11c UTSW 5 86289233 missense probably benign 0.01
R6681:Tmprss11c UTSW 5 86289260 start codon destroyed possibly damaging 0.59
R7170:Tmprss11c UTSW 5 86237619 critical splice donor site probably null
R7198:Tmprss11c UTSW 5 86231832 missense probably damaging 1.00
R7258:Tmprss11c UTSW 5 86271413 missense probably damaging 1.00
R7382:Tmprss11c UTSW 5 86231864 missense probably benign 0.19
R7391:Tmprss11c UTSW 5 86237791 missense probably damaging 1.00
R7590:Tmprss11c UTSW 5 86239473 missense probably benign 0.01
R7894:Tmprss11c UTSW 5 86231796 missense probably damaging 1.00
R8164:Tmprss11c UTSW 5 86231853 missense probably damaging 1.00
R8311:Tmprss11c UTSW 5 86235553 missense probably damaging 1.00
R8416:Tmprss11c UTSW 5 86239417 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACCAAGGTAGCAGAGAG -3'
(R):5'- GTTAGGCTAGCATCATTTCAAGTAC -3'

Sequencing Primer
(F):5'- CTCACTAAAGATATGCCAAACT -3'
(R):5'- GTCTCCCCTGCCATTTCAACAAAAG -3'
Posted On2020-10-20