Mutagenetix > Incidental Mutation

Incidental Mutation 'R0284:Dsg1a'

65349

Institutional Source

Beutler Lab

Gene Symbol

Dsg1a

Ensembl Gene

ENSMUSG00000069441

Gene Name

desmoglein 1 alpha

Synonyms

Dsg1

MMRRC Submission

038505-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R0284 (G1)

Quality Score

160

Status

Validated

Chromosome

Chromosomal Location

20310811-20343350 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 20331627 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 393 (V393E)

Ref Sequence

ENSEMBL: ENSMUSP00000076393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077146]

AlphaFold

Q61495

Predicted Effect

probably damaging
Transcript: ENSMUST00000077146
AA Change: V393E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000076393
Gene: ENSMUSG00000069441
AA Change: V393E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	70	155	3.45e-14	SMART
CA	179	267	3.11e-21	SMART
CA	290	384	6.29e-8	SMART
CA	407	485	6.44e-1	SMART
low complexity region	573	584	N/A	INTRINSIC
low complexity region	590	598	N/A	INTRINSIC
Pfam:Cadherin_C	659	781	1.6e-10	PFAM
low complexity region	786	799	N/A	INTRINSIC
internal_repeat_1	823	888	9.56e-6	PROSPERO
internal_repeat_1	908	975	9.56e-6	PROSPERO
low complexity region	983	1004	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.9%
20x: 92.4%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	G	4: 41,507,538	E150A	probably damaging	Het
Akap2	T	C	4: 57,855,207	F220L	probably damaging	Het
Alkbh6	A	G	7: 30,313,988	T161A	probably benign	Het
Alox12e	A	G	11: 70,320,899		probably benign	Het
Ap1g2	A	G	14: 55,101,692		probably benign	Het
Arid2	A	T	15: 96,378,967		probably benign	Het
Bmp2k	A	T	5: 97,068,455	H604L	unknown	Het
Cacna1a	A	T	8: 84,612,285	M1705L	probably damaging	Het
Cacna1d	A	T	14: 30,072,105	D1526E	probably damaging	Het
Ccdc171	A	G	4: 83,549,738	R107G	possibly damaging	Het
Cklf	T	C	8: 104,261,575		probably benign	Het
Crabp1	A	G	9: 54,764,926	K9E	probably benign	Het
Cspg4	A	G	9: 56,886,139	D386G	probably damaging	Het
Cyp3a41b	G	A	5: 145,578,204		probably benign	Het
Ednrb	C	T	14: 103,820,013	G371D	probably damaging	Het
Efcab5	T	C	11: 77,103,527		probably benign	Het
Exoc2	A	T	13: 30,877,625		probably benign	Het
Fbn2	G	A	18: 58,050,290		probably benign	Het
Foxo6	T	C	4: 120,269,002	S199G	probably benign	Het
Fpr1	T	A	17: 17,877,356	I124F	probably damaging	Het
Gk5	A	T	9: 96,181,770		probably null	Het
Gys1	A	T	7: 45,436,719		probably benign	Het
Igfbp1	T	C	11: 7,198,103	S49P	probably damaging	Het
Incenp	A	T	19: 9,893,993	S91T	unknown	Het
Itpkc	G	A	7: 27,214,543	R498*	probably null	Het
Kat6a	A	G	8: 22,939,803	T1725A	unknown	Het
Kiz	T	A	2: 146,863,810	C97S	probably benign	Het
Kri1	A	G	9: 21,276,552		probably benign	Het
Lipn	A	G	19: 34,080,706	S276G	possibly damaging	Het
Llgl1	A	G	11: 60,712,141	T881A	probably damaging	Het
Man1a2	T	C	3: 100,684,786	H26R	probably damaging	Het
Map3k5	T	A	10: 20,000,613	F173I	probably damaging	Het
Miox	C	T	15: 89,336,274	L189F	possibly damaging	Het
Mipol1	A	G	12: 57,457,069	Q341R	probably damaging	Het
Mllt6	G	T	11: 97,678,605	A928S	probably benign	Het
Ncoa6	TGC	TGCGC	2: 155,408,291		probably null	Het
Nipsnap3a	C	T	4: 52,997,178	T150I	probably benign	Het
Nsl1	A	G	1: 191,065,230	E97G	probably damaging	Het
Olfr1278	T	C	2: 111,292,586	V106A	probably benign	Het
Olfr251	G	A	9: 38,378,584	M234I	probably benign	Het
Olfr736	G	A	14: 50,392,995	V80M	probably damaging	Het
Olfr830	A	T	9: 18,875,552	Y72F	probably benign	Het
Pdcd6ip	A	G	9: 113,662,504	L552S	probably damaging	Het
Plekhf2	T	C	4: 10,990,595		probably benign	Het
Prdm1	T	C	10: 44,456,626	E96G	probably damaging	Het
Prpf40a	T	A	2: 53,150,647	E608D	probably damaging	Het
Prpf40b	A	T	15: 99,316,393		probably benign	Het
Rag2	T	C	2: 101,630,119	V258A	probably damaging	Het
S100a5	A	G	3: 90,611,574	I68V	probably benign	Het
Serpinb8	G	A	1: 107,602,918		probably null	Het
Slc24a4	T	C	12: 102,260,481	V492A	probably damaging	Het
Spag6l	T	A	16: 16,780,766	Q287L	probably damaging	Het
Synpo2	C	T	3: 123,079,734	W211*	probably null	Het
Tgtp1	A	G	11: 48,987,143	V245A	probably benign	Het
Tmem144	G	A	3: 79,839,273		probably benign	Het
Trerf1	A	G	17: 47,319,545		noncoding transcript	Het
Ttn	G	C	2: 76,846,704		probably benign	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Vps13d	A	T	4: 145,144,802	M1900K	probably benign	Het
Vps41	A	T	13: 18,853,440	D691V	probably damaging	Het
Zfp518b	T	C	5: 38,671,740	Y974C	probably damaging	Het
Zscan29	A	T	2: 121,166,733		probably benign	Het

Other mutations in Dsg1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01064:Dsg1a	APN	18	20340206	missense	probably damaging	1.00
IGL01148:Dsg1a	APN	18	20320925	missense	probably damaging	0.97
IGL01534:Dsg1a	APN	18	20340996	missense	probably benign	0.06
IGL01566:Dsg1a	APN	18	20336783	splice site	probably benign
IGL01582:Dsg1a	APN	18	20328848	missense	probably null	1.00
IGL01913:Dsg1a	APN	18	20322236	missense	probably damaging	1.00
IGL01926:Dsg1a	APN	18	20333584	missense	possibly damaging	0.60
IGL02102:Dsg1a	APN	18	20332032	missense	probably benign	0.01
IGL02900:Dsg1a	APN	18	20328656	splice site	probably benign
IGL02937:Dsg1a	APN	18	20331534	missense	possibly damaging	0.93
IGL02962:Dsg1a	APN	18	20340324	missense	possibly damaging	0.92
IGL03003:Dsg1a	APN	18	20336819	missense	probably benign	0.43
PIT4687001:Dsg1a	UTSW	18	20331698	missense	probably benign	0.16
R0126:Dsg1a	UTSW	18	20340878	missense	probably benign	0.00
R0200:Dsg1a	UTSW	18	20340938	missense	probably benign	0.00
R0394:Dsg1a	UTSW	18	20333750	missense	probably damaging	1.00
R0543:Dsg1a	UTSW	18	20340863	missense	probably damaging	1.00
R0656:Dsg1a	UTSW	18	20335892	splice site	probably benign
R0733:Dsg1a	UTSW	18	20338668	missense	probably damaging	0.97
R0750:Dsg1a	UTSW	18	20340153	missense	probably benign	0.10
R1300:Dsg1a	UTSW	18	20332149	missense	probably benign	0.19
R1501:Dsg1a	UTSW	18	20332019	missense	probably damaging	1.00
R1523:Dsg1a	UTSW	18	20322317	missense	probably damaging	0.99
R1673:Dsg1a	UTSW	18	20331504	missense	probably damaging	1.00
R1980:Dsg1a	UTSW	18	20338650	missense	probably damaging	1.00
R2102:Dsg1a	UTSW	18	20333773	missense	probably damaging	1.00
R2132:Dsg1a	UTSW	18	20340797	missense	probably damaging	1.00
R2299:Dsg1a	UTSW	18	20340150	missense	probably damaging	1.00
R2426:Dsg1a	UTSW	18	20336804	missense	probably damaging	0.96
R3031:Dsg1a	UTSW	18	20340492	missense	probably damaging	1.00
R4044:Dsg1a	UTSW	18	20324030	missense	probably damaging	1.00
R4075:Dsg1a	UTSW	18	20340070	missense	possibly damaging	0.53
R4644:Dsg1a	UTSW	18	20340728	missense	probably benign	0.04
R4661:Dsg1a	UTSW	18	20340533	missense	probably damaging	0.99
R4816:Dsg1a	UTSW	18	20333722	missense	probably benign	0.10
R5221:Dsg1a	UTSW	18	20324014	missense	possibly damaging	0.64
R5257:Dsg1a	UTSW	18	20320931	missense	probably damaging	1.00
R5360:Dsg1a	UTSW	18	20340954	missense	probably damaging	0.96
R5547:Dsg1a	UTSW	18	20336040	critical splice donor site	probably null
R5702:Dsg1a	UTSW	18	20336865	critical splice donor site	probably null
R5987:Dsg1a	UTSW	18	20331542	missense	probably damaging	1.00
R6108:Dsg1a	UTSW	18	20340247	missense	probably benign	0.19
R6170:Dsg1a	UTSW	18	20335986	missense	probably damaging	0.99
R7018:Dsg1a	UTSW	18	20328738	missense	possibly damaging	0.48
R7201:Dsg1a	UTSW	18	20328311	missense	probably damaging	0.98
R7730:Dsg1a	UTSW	18	20331711	missense	possibly damaging	0.77
R7814:Dsg1a	UTSW	18	20338515	splice site	probably null
R8185:Dsg1a	UTSW	18	20340612	missense	probably damaging	1.00
R8297:Dsg1a	UTSW	18	20332033	missense	probably benign	0.02
R8377:Dsg1a	UTSW	18	20333774	missense	probably damaging	1.00
R8409:Dsg1a	UTSW	18	20340151	missense	probably damaging	1.00
R8775:Dsg1a	UTSW	18	20340507	missense	probably damaging	0.98
R8775-TAIL:Dsg1a	UTSW	18	20340507	missense	probably damaging	0.98
R8818:Dsg1a	UTSW	18	20340542	missense	possibly damaging	0.87
R8821:Dsg1a	UTSW	18	20320308	missense	probably damaging	0.96
R8831:Dsg1a	UTSW	18	20320308	missense	probably damaging	0.96
R9030:Dsg1a	UTSW	18	20340492	missense	probably damaging	1.00
R9205:Dsg1a	UTSW	18	20340171	missense	probably damaging	1.00
R9239:Dsg1a	UTSW	18	20340693	missense	probably damaging	1.00
R9410:Dsg1a	UTSW	18	20331533	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- GTTCCCAACAAGTAACACTGGACTGG -3'
(R):5'- ACACACTTTGTCAAATCCACTTTGTGC -3'

Sequencing Primer
(F):5'- CTGTTCTAGCCCCTAGATTATGAAG -3'
(R):5'- GTCAAATCCACTTTGTGCTCATTC -3'

Posted On

2013-08-08