Incidental Mutation 'R0285:Stxbp1'
ID 65350
Institutional Source Beutler Lab
Gene Symbol Stxbp1
Ensembl Gene ENSMUSG00000026797
Gene Name syntaxin binding protein 1
Synonyms Munc-18a, Sxtbp1, N-sec1, nsec1, Munc18-1, Rb-sec1, Unc18h
MMRRC Submission 038506-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.635) question?
Stock # R0285 (G1)
Quality Score 149
Status Validated
Chromosome 2
Chromosomal Location 32677619-32737249 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 32713554 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 27 (E27D)
Ref Sequence ENSEMBL: ENSMUSP00000089051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050000] [ENSMUST00000077458] [ENSMUST00000208840]
AlphaFold O08599
Predicted Effect probably benign
Transcript: ENSMUST00000050000
AA Change: E27D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000052440
Gene: ENSMUSG00000026797
AA Change: E27D

DomainStartEndE-ValueType
Pfam:Sec1 28 582 9.8e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077458
AA Change: E27D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000089051
Gene: ENSMUSG00000026797
AA Change: E27D

DomainStartEndE-ValueType
Pfam:Sec1 29 581 2.8e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208840
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.1%
  • 20x: 92.9%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a syntaxin-binding protein. The encoded protein appears to play a role in release of neurotransmitters via regulation of syntaxin, a transmembrane attachment protein receptor. Mutations in this gene have been associated with infantile epileptic encephalopathy-4. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit total loss of neurotransmitter secretion from synaptic vesicles throughout development and massive neuron apoptosis after initial synaptogenesis, leading to widespread neurodegeneration and complete neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy3 A G 19: 4,038,193 (GRCm39) E162G probably benign Het
Angptl1 T C 1: 156,672,785 (GRCm39) S204P probably benign Het
Atf6b C T 17: 34,869,370 (GRCm39) probably benign Het
Card11 G A 5: 140,872,856 (GRCm39) S619F probably damaging Het
Ccdc192 G A 18: 57,666,937 (GRCm39) G5S probably damaging Het
Ccl11 G A 11: 81,953,084 (GRCm39) V81I probably damaging Het
Cds1 T C 5: 101,944,904 (GRCm39) I126T probably damaging Het
Chd1 A G 17: 17,594,942 (GRCm39) probably benign Het
Cndp1 C A 18: 84,636,363 (GRCm39) V384F possibly damaging Het
Cuta A G 17: 27,158,423 (GRCm39) probably null Het
Diaph3 G A 14: 87,352,460 (GRCm39) T47I possibly damaging Het
Dop1a A T 9: 86,394,692 (GRCm39) S598C probably damaging Het
Dsp A G 13: 38,356,770 (GRCm39) M217V probably benign Het
Entrep1 G A 19: 23,956,749 (GRCm39) probably benign Het
Esyt1 T A 10: 128,348,087 (GRCm39) I898F possibly damaging Het
Fcsk G C 8: 111,620,349 (GRCm39) H235Q probably benign Het
Fgd3 A T 13: 49,417,424 (GRCm39) W680R possibly damaging Het
Folh1 A G 7: 86,391,373 (GRCm39) probably benign Het
Gadl1 C A 9: 115,859,806 (GRCm39) probably benign Het
Garem1 A G 18: 21,262,669 (GRCm39) M715T probably benign Het
Gpd2 A T 2: 57,228,967 (GRCm39) D257V probably benign Het
Hdac7 A G 15: 97,696,103 (GRCm39) probably null Het
Heatr5b A G 17: 79,115,882 (GRCm39) M858T probably benign Het
Inpp4b A T 8: 82,761,145 (GRCm39) probably benign Het
Iqgap3 G T 3: 88,004,297 (GRCm39) C461F probably benign Het
Lamb1 C A 12: 31,376,644 (GRCm39) C559* probably null Het
Lratd2 T C 15: 60,694,816 (GRCm39) H310R probably benign Het
Lrrc31 T C 3: 30,739,097 (GRCm39) N308S probably benign Het
Ly75 T C 2: 60,148,663 (GRCm39) Y1222C probably damaging Het
Map3k10 C A 7: 27,373,325 (GRCm39) R42L probably benign Het
Meioc A G 11: 102,563,017 (GRCm39) T72A probably benign Het
Miox C T 15: 89,220,477 (GRCm39) L189F possibly damaging Het
Mmp11 T C 10: 75,761,502 (GRCm39) Y366C probably damaging Het
N4bp2 T A 5: 65,963,902 (GRCm39) D650E probably benign Het
Ncoa6 T C 2: 155,257,621 (GRCm39) M641V probably damaging Het
Ncoa6 TGC TGCGC 2: 155,250,211 (GRCm39) probably null Het
Nol4l G A 2: 153,325,773 (GRCm39) probably benign Het
Notch1 T G 2: 26,350,873 (GRCm39) D2089A possibly damaging Het
Or10q3 A G 19: 11,848,502 (GRCm39) L26P probably damaging Het
Or13c7 G A 4: 43,854,398 (GRCm39) V30M possibly damaging Het
Or52h2 A T 7: 103,838,531 (GRCm39) Y294* probably null Het
Or5b24 A T 19: 12,912,536 (GRCm39) M145L probably benign Het
Or5l13 A G 2: 87,780,475 (GRCm39) I34T probably damaging Het
Or5p68 A G 7: 107,945,706 (GRCm39) S161P probably benign Het
Or8d23 T A 9: 38,842,070 (GRCm39) I201N possibly damaging Het
Otof C T 5: 30,536,877 (GRCm39) probably null Het
Paox T C 7: 139,709,053 (GRCm39) F324L probably damaging Het
Pycr1 A T 11: 120,531,142 (GRCm39) I277N probably benign Het
R3hcc1l A T 19: 42,564,568 (GRCm39) H627L probably damaging Het
Rab21 G A 10: 115,126,768 (GRCm39) S193L probably benign Het
Ralgds T G 2: 28,440,581 (GRCm39) probably null Het
Rbm42 A G 7: 30,345,265 (GRCm39) S169P possibly damaging Het
Rfpl4 A G 7: 5,113,377 (GRCm39) V262A probably benign Het
Rhobtb3 A G 13: 76,025,628 (GRCm39) I496T possibly damaging Het
Rnf31 G A 14: 55,838,846 (GRCm39) A901T probably damaging Het
Ryr2 T C 13: 11,731,863 (GRCm39) D2359G probably damaging Het
Sgo2b A C 8: 64,381,823 (GRCm39) Y336* probably null Het
Slc16a7 T A 10: 125,130,500 (GRCm39) I62L probably benign Het
Slc22a21 A T 11: 53,850,022 (GRCm39) probably benign Het
Slc25a21 A G 12: 56,904,810 (GRCm39) probably null Het
Slc5a4b T C 10: 75,898,117 (GRCm39) I532M probably damaging Het
Spata31f1a G A 4: 42,850,236 (GRCm39) T640M probably benign Het
Srrm4 C A 5: 116,605,848 (GRCm39) probably benign Het
Sult2a5 T A 7: 13,362,685 (GRCm39) Y131N probably damaging Het
Svopl T C 6: 37,961,457 (GRCm39) Q492R probably benign Het
Tmem144 G A 3: 79,746,580 (GRCm39) probably benign Het
Tmem87a A G 2: 120,224,905 (GRCm39) S119P probably benign Het
Tmprss11c A G 5: 86,419,289 (GRCm39) L90P probably damaging Het
Tmprss6 T A 15: 78,337,068 (GRCm39) D346V probably damaging Het
Ubr4 A C 4: 139,168,112 (GRCm39) S2820R probably damaging Het
Usp4 T C 9: 108,255,763 (GRCm39) V607A probably benign Het
Usp45 A G 4: 21,798,603 (GRCm39) probably null Het
Vill C T 9: 118,899,895 (GRCm39) probably benign Het
Vmn1r13 C A 6: 57,186,979 (GRCm39) T46N probably benign Het
Vmn2r107 A G 17: 20,565,873 (GRCm39) T63A probably benign Het
Vmn2r82 T A 10: 79,232,391 (GRCm39) W797R probably damaging Het
Washc2 T A 6: 116,198,800 (GRCm39) D287E probably damaging Het
Xpc G A 6: 91,475,046 (GRCm39) L660F probably damaging Het
Other mutations in Stxbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Stxbp1 APN 2 32,702,076 (GRCm39) missense probably benign 0.00
IGL02743:Stxbp1 APN 2 32,709,913 (GRCm39) missense probably damaging 0.98
volume UTSW 2 32,691,905 (GRCm39) missense probably damaging 0.99
volume2 UTSW 2 32,691,895 (GRCm39) missense possibly damaging 0.95
P0021:Stxbp1 UTSW 2 32,713,550 (GRCm39) missense probably damaging 0.96
R0217:Stxbp1 UTSW 2 32,691,882 (GRCm39) missense possibly damaging 0.69
R0269:Stxbp1 UTSW 2 32,692,795 (GRCm39) missense probably damaging 1.00
R0335:Stxbp1 UTSW 2 32,692,917 (GRCm39) splice site probably benign
R0565:Stxbp1 UTSW 2 32,709,860 (GRCm39) missense probably benign 0.07
R0617:Stxbp1 UTSW 2 32,692,795 (GRCm39) missense probably damaging 1.00
R0690:Stxbp1 UTSW 2 32,690,707 (GRCm39) splice site probably benign
R1022:Stxbp1 UTSW 2 32,704,979 (GRCm39) splice site probably null
R1024:Stxbp1 UTSW 2 32,704,979 (GRCm39) splice site probably null
R1295:Stxbp1 UTSW 2 32,684,648 (GRCm39) missense probably benign 0.18
R1296:Stxbp1 UTSW 2 32,684,648 (GRCm39) missense probably benign 0.18
R1472:Stxbp1 UTSW 2 32,684,648 (GRCm39) missense probably benign 0.18
R1699:Stxbp1 UTSW 2 32,690,629 (GRCm39) missense probably damaging 0.99
R1744:Stxbp1 UTSW 2 32,696,731 (GRCm39) critical splice donor site probably null
R2004:Stxbp1 UTSW 2 32,688,201 (GRCm39) missense probably damaging 0.99
R2151:Stxbp1 UTSW 2 32,692,868 (GRCm39) missense probably damaging 1.00
R2153:Stxbp1 UTSW 2 32,692,868 (GRCm39) missense probably damaging 1.00
R2154:Stxbp1 UTSW 2 32,692,868 (GRCm39) missense probably damaging 1.00
R5170:Stxbp1 UTSW 2 32,684,686 (GRCm39) missense probably benign 0.01
R6083:Stxbp1 UTSW 2 32,686,030 (GRCm39) missense possibly damaging 0.95
R6295:Stxbp1 UTSW 2 32,684,621 (GRCm39) missense probably damaging 0.98
R6504:Stxbp1 UTSW 2 32,691,895 (GRCm39) missense possibly damaging 0.95
R6770:Stxbp1 UTSW 2 32,709,901 (GRCm39) missense probably benign 0.01
R6954:Stxbp1 UTSW 2 32,691,905 (GRCm39) missense probably damaging 0.99
R7283:Stxbp1 UTSW 2 32,705,026 (GRCm39) missense probably damaging 1.00
R7382:Stxbp1 UTSW 2 32,688,180 (GRCm39) missense probably damaging 1.00
R7541:Stxbp1 UTSW 2 32,708,517 (GRCm39) missense probably damaging 0.99
R7734:Stxbp1 UTSW 2 32,691,832 (GRCm39) missense probably benign 0.00
R8364:Stxbp1 UTSW 2 32,696,774 (GRCm39) missense possibly damaging 0.72
R8462:Stxbp1 UTSW 2 32,707,293 (GRCm39) splice site probably null
R9143:Stxbp1 UTSW 2 32,688,157 (GRCm39) missense probably damaging 0.99
R9246:Stxbp1 UTSW 2 32,679,586 (GRCm39) missense possibly damaging 0.85
R9267:Stxbp1 UTSW 2 32,708,517 (GRCm39) missense probably damaging 1.00
R9501:Stxbp1 UTSW 2 32,692,825 (GRCm39) missense probably benign 0.00
R9600:Stxbp1 UTSW 2 32,701,120 (GRCm39) missense possibly damaging 0.80
RF010:Stxbp1 UTSW 2 32,711,927 (GRCm39) missense probably benign 0.06
X0060:Stxbp1 UTSW 2 32,692,780 (GRCm39) missense probably damaging 1.00
Z1177:Stxbp1 UTSW 2 32,699,140 (GRCm39) missense probably damaging 0.99
Z1177:Stxbp1 UTSW 2 32,692,766 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGAACCACGCTCATGCACC -3'
(R):5'- AGCAAGCCTGGGAAAGATGCTC -3'

Sequencing Primer
(F):5'- gcacttagccactcgcc -3'
(R):5'- TATtccctctctctctctctctctc -3'
Posted On 2013-08-08