Incidental Mutation 'R8427:Tnn'
ID 653501
Institutional Source Beutler Lab
Gene Symbol Tnn
Ensembl Gene ENSMUSG00000026725
Gene Name tenascin N
Synonyms tenascin-W, Tnw
MMRRC Submission 067821-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.396) question?
Stock # R8427 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 159912599-159981150 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 159958256 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 529 (T529I)
Ref Sequence ENSEMBL: ENSMUSP00000039452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039178] [ENSMUST00000131919]
AlphaFold Q80Z71
Predicted Effect probably damaging
Transcript: ENSMUST00000039178
AA Change: T529I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039452
Gene: ENSMUSG00000026725
AA Change: T529I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.34e-9 SMART
FN3 883 960 9.04e-9 SMART
FN3 971 1048 1.07e-10 SMART
FN3 1059 1136 7.57e-11 SMART
FN3 1147 1224 4.59e-10 SMART
FN3 1235 1312 1.95e-4 SMART
FBG 1327 1539 1.16e-114 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131919
AA Change: T529I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115685
Gene: ENSMUSG00000026725
AA Change: T529I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.57e-11 SMART
FN3 883 960 4.59e-10 SMART
FN3 971 1048 1.95e-4 SMART
FBG 1063 1275 1.16e-114 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik G T 12: 72,950,060 (GRCm39) S271R possibly damaging Het
Adrb2 A G 18: 62,312,345 (GRCm39) V160A possibly damaging Het
Atp13a5 T C 16: 29,167,820 (GRCm39) D113G possibly damaging Het
B4galt7 T A 13: 55,757,138 (GRCm39) V312D possibly damaging Het
Bccip A G 7: 133,311,220 (GRCm39) D45G probably benign Het
Bcl2l2 A G 14: 55,122,860 (GRCm39) Y151C probably damaging Het
Ccdc146 T C 5: 21,604,790 (GRCm39) E16G unknown Het
Cdr2l C A 11: 115,284,865 (GRCm39) D400E probably damaging Het
Celsr2 A C 3: 108,299,949 (GRCm39) *2920E probably null Het
Cib1 A G 7: 79,877,749 (GRCm39) F183L probably damaging Het
Cnot1 A G 8: 96,460,952 (GRCm39) Y1716H probably benign Het
Copb1 A G 7: 113,825,989 (GRCm39) V665A probably benign Het
Crmp1 C T 5: 37,448,539 (GRCm39) T683I probably damaging Het
Cubn G C 2: 13,433,567 (GRCm39) F1114L probably benign Het
Dab2 A T 15: 6,458,840 (GRCm39) R251* probably null Het
Ddx28 A G 8: 106,736,912 (GRCm39) V382A probably benign Het
Eml1 C A 12: 108,496,580 (GRCm39) T612K probably damaging Het
Hoxb3 CGGCGGTGGCGG CGGCGGTGGCGGTGGCGG 11: 96,236,415 (GRCm39) probably benign Het
Hoxb3 TGGCGG TGGCGGAGGCGG 11: 96,236,421 (GRCm39) probably benign Het
Iapp T A 6: 142,244,612 (GRCm39) I13N probably damaging Het
Ifit1bl1 A T 19: 34,576,666 (GRCm39) probably null Het
Itgb4 T A 11: 115,882,544 (GRCm39) probably null Het
Kcnh3 T C 15: 99,124,934 (GRCm39) V128A probably benign Het
Kmt2a A G 9: 44,756,720 (GRCm39) F1176L probably damaging Het
Lifr A G 15: 7,220,462 (GRCm39) T1031A probably benign Het
Lrp2 T C 2: 69,281,641 (GRCm39) D3910G probably damaging Het
Man1a2 A T 3: 100,592,001 (GRCm39) S60T probably benign Het
Mdh1 C T 11: 21,514,138 (GRCm39) R93K probably benign Het
Mical1 G T 10: 41,354,591 (GRCm39) K142N probably damaging Het
Nf2 T A 11: 4,741,118 (GRCm39) E365D probably benign Het
Nfrkb A G 9: 31,330,323 (GRCm39) M1192V probably benign Het
Npas4 A C 19: 5,036,108 (GRCm39) D685E probably benign Het
Or11h4b T A 14: 50,918,606 (GRCm39) I162F probably damaging Het
Or12k5 G T 2: 36,894,794 (GRCm39) Y277* probably null Het
Or4f4-ps1 A G 2: 111,330,310 (GRCm39) T238A probably damaging Het
Ovch2 G A 7: 107,393,207 (GRCm39) T222I probably damaging Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Pld1 A T 3: 28,142,795 (GRCm39) I668F probably damaging Het
Plscr4 C T 9: 92,372,843 (GRCm39) R322* probably null Het
Ppa1 A G 10: 61,496,704 (GRCm39) D64G possibly damaging Het
Rnf133 T C 6: 23,649,405 (GRCm39) I175V probably benign Het
Rpp30 A G 19: 36,071,812 (GRCm39) I127V probably benign Het
Scube2 T A 7: 109,399,797 (GRCm39) H913L probably damaging Het
Sema6d T A 2: 124,507,197 (GRCm39) S1045T probably benign Het
Skida1 A T 2: 18,051,402 (GRCm39) N496K unknown Het
Slc29a2 A T 19: 5,080,448 (GRCm39) I397F probably benign Het
Slc38a2 G T 15: 96,590,294 (GRCm39) R316S probably damaging Het
Slc40a1 A C 1: 45,951,498 (GRCm39) Y220D probably damaging Het
Strc T G 2: 121,208,012 (GRCm39) H453P probably damaging Het
Tmprss3 T A 17: 31,407,358 (GRCm39) I312F probably damaging Het
Tnr A T 1: 159,713,801 (GRCm39) D743V possibly damaging Het
Trim42 A T 9: 97,245,174 (GRCm39) F542Y probably benign Het
Trpm2 A T 10: 77,747,236 (GRCm39) Y1421N possibly damaging Het
Ttn T C 2: 76,576,901 (GRCm39) E24664G probably damaging Het
Ube2q2 T C 9: 55,092,250 (GRCm39) probably null Het
Unc79 A T 12: 103,045,297 (GRCm39) R824S probably benign Het
V1ra8 A G 6: 90,180,559 (GRCm39) D254G probably damaging Het
Vmn1r173 A T 7: 23,401,959 (GRCm39) I65F probably damaging Het
Vmn2r16 T A 5: 109,488,138 (GRCm39) M337K probably benign Het
Wfs1 C A 5: 37,125,431 (GRCm39) G487C probably damaging Het
Xdh T C 17: 74,242,926 (GRCm39) Y127C probably damaging Het
Zfp229 T C 17: 21,965,815 (GRCm39) S682P probably damaging Het
Zscan4-ps1 A T 7: 10,802,447 (GRCm39) D117E possibly damaging Het
Other mutations in Tnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tnn APN 1 159,953,021 (GRCm39) missense possibly damaging 0.65
IGL00433:Tnn APN 1 159,925,776 (GRCm39) splice site probably benign
IGL00858:Tnn APN 1 159,915,962 (GRCm39) critical splice donor site probably null
IGL00939:Tnn APN 1 159,975,100 (GRCm39) missense probably damaging 1.00
IGL01569:Tnn APN 1 159,948,124 (GRCm39) missense possibly damaging 0.51
IGL01591:Tnn APN 1 159,953,144 (GRCm39) missense probably damaging 1.00
IGL01628:Tnn APN 1 159,975,172 (GRCm39) missense possibly damaging 0.89
IGL01811:Tnn APN 1 159,934,705 (GRCm39) missense probably damaging 1.00
IGL01813:Tnn APN 1 159,916,008 (GRCm39) missense probably damaging 1.00
IGL02340:Tnn APN 1 159,972,775 (GRCm39) missense probably benign 0.00
IGL02488:Tnn APN 1 159,968,163 (GRCm39) missense probably benign 0.21
IGL02535:Tnn APN 1 159,950,222 (GRCm39) splice site probably null
IGL02563:Tnn APN 1 159,942,123 (GRCm39) missense probably damaging 1.00
IGL02572:Tnn APN 1 159,913,677 (GRCm39) missense probably damaging 1.00
IGL02740:Tnn APN 1 159,968,347 (GRCm39) splice site probably benign
IGL02818:Tnn APN 1 159,943,848 (GRCm39) missense possibly damaging 0.86
IGL03284:Tnn APN 1 159,953,022 (GRCm39) missense probably benign 0.01
1mM(1):Tnn UTSW 1 159,924,911 (GRCm39) missense probably damaging 1.00
PIT4305001:Tnn UTSW 1 159,913,647 (GRCm39) missense possibly damaging 0.91
R0023:Tnn UTSW 1 159,932,498 (GRCm39) missense probably benign 0.00
R0234:Tnn UTSW 1 159,916,036 (GRCm39) missense probably damaging 1.00
R0234:Tnn UTSW 1 159,916,036 (GRCm39) missense probably damaging 1.00
R0316:Tnn UTSW 1 159,948,137 (GRCm39) missense possibly damaging 0.93
R0492:Tnn UTSW 1 159,948,327 (GRCm39) missense probably damaging 0.99
R0547:Tnn UTSW 1 159,943,907 (GRCm39) intron probably benign
R1067:Tnn UTSW 1 159,952,968 (GRCm39) missense probably damaging 1.00
R1563:Tnn UTSW 1 159,952,985 (GRCm39) missense probably damaging 1.00
R1565:Tnn UTSW 1 159,924,835 (GRCm39) missense probably damaging 1.00
R1615:Tnn UTSW 1 159,945,978 (GRCm39) missense possibly damaging 0.93
R1637:Tnn UTSW 1 159,975,170 (GRCm39) missense probably damaging 1.00
R1707:Tnn UTSW 1 159,972,714 (GRCm39) missense probably damaging 1.00
R1758:Tnn UTSW 1 159,975,154 (GRCm39) missense possibly damaging 0.61
R1797:Tnn UTSW 1 159,968,258 (GRCm39) missense probably damaging 1.00
R1847:Tnn UTSW 1 159,943,752 (GRCm39) missense possibly damaging 0.51
R1925:Tnn UTSW 1 159,924,799 (GRCm39) missense probably damaging 1.00
R2182:Tnn UTSW 1 159,968,170 (GRCm39) splice site probably null
R2196:Tnn UTSW 1 159,924,798 (GRCm39) nonsense probably null
R2225:Tnn UTSW 1 159,975,035 (GRCm39) missense probably damaging 1.00
R2227:Tnn UTSW 1 159,975,035 (GRCm39) missense probably damaging 1.00
R2286:Tnn UTSW 1 159,938,079 (GRCm39) missense possibly damaging 0.89
R2850:Tnn UTSW 1 159,966,857 (GRCm39) missense probably benign 0.00
R3110:Tnn UTSW 1 159,943,856 (GRCm39) missense possibly damaging 0.71
R3111:Tnn UTSW 1 159,934,625 (GRCm39) missense probably damaging 0.98
R3112:Tnn UTSW 1 159,943,856 (GRCm39) missense possibly damaging 0.71
R3729:Tnn UTSW 1 159,973,810 (GRCm39) missense probably damaging 1.00
R4183:Tnn UTSW 1 159,924,925 (GRCm39) missense probably damaging 1.00
R4439:Tnn UTSW 1 159,943,650 (GRCm39) missense probably benign
R4441:Tnn UTSW 1 159,943,650 (GRCm39) missense probably benign
R4588:Tnn UTSW 1 159,972,681 (GRCm39) missense probably benign 0.25
R4646:Tnn UTSW 1 159,973,612 (GRCm39) missense probably benign
R4647:Tnn UTSW 1 159,973,612 (GRCm39) missense probably benign
R4648:Tnn UTSW 1 159,973,612 (GRCm39) missense probably benign
R4701:Tnn UTSW 1 159,975,338 (GRCm39) missense possibly damaging 0.72
R4703:Tnn UTSW 1 159,943,815 (GRCm39) missense possibly damaging 0.84
R4737:Tnn UTSW 1 159,973,659 (GRCm39) missense probably damaging 1.00
R4801:Tnn UTSW 1 159,972,603 (GRCm39) missense possibly damaging 0.90
R4802:Tnn UTSW 1 159,972,603 (GRCm39) missense possibly damaging 0.90
R4868:Tnn UTSW 1 159,958,443 (GRCm39) missense possibly damaging 0.64
R4977:Tnn UTSW 1 159,948,188 (GRCm39) missense probably damaging 1.00
R5011:Tnn UTSW 1 159,953,949 (GRCm39) missense possibly damaging 0.89
R5026:Tnn UTSW 1 159,973,707 (GRCm39) missense probably benign 0.00
R5027:Tnn UTSW 1 159,972,781 (GRCm39) missense probably damaging 1.00
R5049:Tnn UTSW 1 159,968,308 (GRCm39) missense probably benign 0.00
R5119:Tnn UTSW 1 159,948,122 (GRCm39) missense probably damaging 0.98
R5128:Tnn UTSW 1 159,950,464 (GRCm39) missense probably damaging 0.98
R5234:Tnn UTSW 1 159,972,569 (GRCm39) missense possibly damaging 0.95
R5398:Tnn UTSW 1 159,975,092 (GRCm39) missense probably benign 0.00
R5424:Tnn UTSW 1 159,950,272 (GRCm39) missense possibly damaging 0.69
R5452:Tnn UTSW 1 159,937,831 (GRCm39) missense probably benign 0.13
R5466:Tnn UTSW 1 159,948,106 (GRCm39) missense possibly damaging 0.93
R6022:Tnn UTSW 1 159,937,928 (GRCm39) missense probably benign 0.00
R6062:Tnn UTSW 1 159,925,848 (GRCm39) missense probably damaging 1.00
R6086:Tnn UTSW 1 159,913,690 (GRCm39) missense probably damaging 1.00
R6132:Tnn UTSW 1 159,973,641 (GRCm39) missense probably damaging 0.96
R6324:Tnn UTSW 1 159,972,774 (GRCm39) missense probably damaging 0.96
R6455:Tnn UTSW 1 159,942,289 (GRCm39) missense probably damaging 1.00
R6563:Tnn UTSW 1 159,915,968 (GRCm39) missense probably damaging 1.00
R6650:Tnn UTSW 1 159,942,153 (GRCm39) missense probably damaging 1.00
R6806:Tnn UTSW 1 159,948,278 (GRCm39) missense possibly damaging 0.95
R6810:Tnn UTSW 1 159,932,412 (GRCm39) missense probably damaging 1.00
R7157:Tnn UTSW 1 159,953,947 (GRCm39) nonsense probably null
R7243:Tnn UTSW 1 159,934,687 (GRCm39) missense probably benign 0.07
R7340:Tnn UTSW 1 159,973,592 (GRCm39) missense probably damaging 0.98
R7472:Tnn UTSW 1 159,937,917 (GRCm39) missense probably benign 0.12
R7502:Tnn UTSW 1 159,937,929 (GRCm39) missense probably benign 0.00
R7527:Tnn UTSW 1 159,946,074 (GRCm39) missense possibly damaging 0.51
R7608:Tnn UTSW 1 159,915,984 (GRCm39) nonsense probably null
R7746:Tnn UTSW 1 159,942,255 (GRCm39) missense probably damaging 0.97
R8096:Tnn UTSW 1 159,950,411 (GRCm39) missense probably damaging 1.00
R8136:Tnn UTSW 1 159,934,630 (GRCm39) missense probably damaging 0.96
R8191:Tnn UTSW 1 159,953,088 (GRCm39) missense probably damaging 1.00
R8334:Tnn UTSW 1 159,946,053 (GRCm39) missense probably damaging 1.00
R8335:Tnn UTSW 1 159,946,053 (GRCm39) missense probably damaging 1.00
R8337:Tnn UTSW 1 159,946,053 (GRCm39) missense probably damaging 1.00
R8338:Tnn UTSW 1 159,946,053 (GRCm39) missense probably damaging 1.00
R8433:Tnn UTSW 1 159,924,790 (GRCm39) missense possibly damaging 0.81
R8479:Tnn UTSW 1 159,950,397 (GRCm39) missense probably benign 0.06
R8505:Tnn UTSW 1 159,973,593 (GRCm39) missense probably damaging 0.98
R8554:Tnn UTSW 1 159,937,986 (GRCm39) missense probably damaging 1.00
R8717:Tnn UTSW 1 159,943,846 (GRCm39) missense possibly damaging 0.51
R8850:Tnn UTSW 1 159,937,814 (GRCm39) critical splice donor site probably null
R8928:Tnn UTSW 1 159,953,099 (GRCm39) missense probably damaging 1.00
R9209:Tnn UTSW 1 159,953,986 (GRCm39) missense probably benign 0.02
X0019:Tnn UTSW 1 159,913,716 (GRCm39) missense probably damaging 1.00
Z1176:Tnn UTSW 1 159,973,863 (GRCm39) missense probably benign
Z1177:Tnn UTSW 1 159,954,097 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATGAAGTTGGGTGAGCAGC -3'
(R):5'- CAAGTATGTGGTGCGCTATATCG -3'

Sequencing Primer
(F):5'- CGAGGCAAGGTGGTATCTG -3'
(R):5'- GAGAGGCCTACAAAGTCTT -3'
Posted On 2020-10-20