Incidental Mutation 'R8427:Skida1'
ID 653503
Institutional Source Beutler Lab
Gene Symbol Skida1
Ensembl Gene ENSMUSG00000054074
Gene Name SKI/DACH domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.238) question?
Stock # R8427 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 18040676-18049051 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 18046591 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 496 (N496K)
Ref Sequence ENSEMBL: ENSMUSP00000068520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066885] [ENSMUST00000091420] [ENSMUST00000142856] [ENSMUST00000152908]
AlphaFold Q80YR3
Predicted Effect unknown
Transcript: ENSMUST00000066885
AA Change: N496K
SMART Domains Protein: ENSMUSP00000068520
Gene: ENSMUSG00000054074
AA Change: N496K

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 98 4.1e-19 PFAM
low complexity region 116 130 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 262 279 N/A INTRINSIC
low complexity region 282 297 N/A INTRINSIC
coiled coil region 315 337 N/A INTRINSIC
Pfam:DUF4584 383 820 9.7e-162 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000091420
AA Change: N583K
SMART Domains Protein: ENSMUSP00000088982
Gene: ENSMUSG00000054074
AA Change: N583K

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 97 7.7e-17 PFAM
low complexity region 116 130 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
SCOP:d1gkub1 224 254 3e-3 SMART
SCOP:d1gkub1 296 321 6e-3 SMART
low complexity region 349 366 N/A INTRINSIC
low complexity region 369 384 N/A INTRINSIC
coiled coil region 402 424 N/A INTRINSIC
Pfam:DUF4584 471 907 7.7e-179 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142856
SMART Domains Protein: ENSMUSP00000122112
Gene: ENSMUSG00000054074

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 98 4.4e-20 PFAM
low complexity region 116 130 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152908
SMART Domains Protein: ENSMUSP00000114785
Gene: ENSMUSG00000054074

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 65 2.8e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik G T 12: 72,903,286 S271R possibly damaging Het
Adrb2 A G 18: 62,179,274 V160A possibly damaging Het
Atp13a5 T C 16: 29,349,002 D113G possibly damaging Het
B4galt7 T A 13: 55,609,325 V312D possibly damaging Het
Bccip A G 7: 133,709,491 D45G probably benign Het
Bcl2l2 A G 14: 54,885,403 Y151C probably damaging Het
Ccdc146 T C 5: 21,399,792 E16G unknown Het
Cdr2l C A 11: 115,394,039 D400E probably damaging Het
Celsr2 A C 3: 108,392,633 *2920E probably null Het
Cib1 A G 7: 80,228,001 F183L probably damaging Het
Cnot1 A G 8: 95,734,324 Y1716H probably benign Het
Copb1 A G 7: 114,226,754 V665A probably benign Het
Crmp1 C T 5: 37,291,195 T683I probably damaging Het
Cubn G C 2: 13,428,756 F1114L probably benign Het
Dab2 A T 15: 6,429,359 R251* probably null Het
Ddx28 A G 8: 106,010,280 V382A probably benign Het
Eml1 C A 12: 108,530,321 T612K probably damaging Het
Hoxb3 CGGCGGTGGCGG CGGCGGTGGCGGTGGCGG 11: 96,345,589 probably benign Het
Hoxb3 TGGCGG TGGCGGAGGCGG 11: 96,345,595 probably benign Het
Iapp T A 6: 142,298,886 I13N probably damaging Het
Ifit1bl1 A T 19: 34,599,266 probably null Het
Itgb4 T A 11: 115,991,718 probably null Het
Kcnh3 T C 15: 99,227,053 V128A probably benign Het
Kmt2a A G 9: 44,845,423 F1176L probably damaging Het
Lifr A G 15: 7,190,981 T1031A probably benign Het
Lrp2 T C 2: 69,451,297 D3910G probably damaging Het
Man1a2 A T 3: 100,684,685 S60T probably benign Het
Mdh1 C T 11: 21,564,138 R93K probably benign Het
Mical1 G T 10: 41,478,595 K142N probably damaging Het
Nf2 T A 11: 4,791,118 E365D probably benign Het
Nfrkb A G 9: 31,419,027 M1192V probably benign Het
Npas4 A C 19: 4,986,080 D685E probably benign Het
Olfr1291-ps1 A G 2: 111,499,965 T238A probably damaging Het
Olfr358 G T 2: 37,004,782 Y277* probably null Het
Olfr747 T A 14: 50,681,149 I162F probably damaging Het
Ovch2 G A 7: 107,794,000 T222I probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pld1 A T 3: 28,088,646 I668F probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ppa1 A G 10: 61,660,925 D64G possibly damaging Het
Rnf133 T C 6: 23,649,406 I175V probably benign Het
Rpp30 A G 19: 36,094,412 I127V probably benign Het
Scube2 T A 7: 109,800,590 H913L probably damaging Het
Sema6d T A 2: 124,665,277 S1045T probably benign Het
Slc29a2 A T 19: 5,030,420 I397F probably benign Het
Slc38a2 G T 15: 96,692,413 R316S probably damaging Het
Slc40a1 A C 1: 45,912,338 Y220D probably damaging Het
Strc T G 2: 121,377,531 H453P probably damaging Het
Tmprss3 T A 17: 31,188,384 I312F probably damaging Het
Tnn G A 1: 160,130,686 T529I probably damaging Het
Tnr A T 1: 159,886,231 D743V possibly damaging Het
Trim42 A T 9: 97,363,121 F542Y probably benign Het
Trpm2 A T 10: 77,911,402 Y1421N possibly damaging Het
Ttn T C 2: 76,746,557 E24664G probably damaging Het
Ube2q2 T C 9: 55,184,966 probably null Het
Unc79 A T 12: 103,079,038 R824S probably benign Het
V1ra8 A G 6: 90,203,577 D254G probably damaging Het
Vmn1r173 A T 7: 23,702,534 I65F probably damaging Het
Vmn2r16 T A 5: 109,340,272 M337K probably benign Het
Wfs1 C A 5: 36,968,087 G487C probably damaging Het
Xdh T C 17: 73,935,931 Y127C probably damaging Het
Zfp229 T C 17: 21,746,834 S682P probably damaging Het
Zscan4-ps1 A T 7: 11,068,520 D117E possibly damaging Het
Other mutations in Skida1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02315:Skida1 APN 2 18046005 unclassified probably benign
IGL03220:Skida1 APN 2 18048161 missense probably damaging 1.00
R0328:Skida1 UTSW 2 18047186 unclassified probably benign
R0732:Skida1 UTSW 2 18046157 unclassified probably benign
R1239:Skida1 UTSW 2 18047317 unclassified probably benign
R1346:Skida1 UTSW 2 18048279 missense possibly damaging 0.92
R1597:Skida1 UTSW 2 18046332 unclassified probably benign
R1867:Skida1 UTSW 2 18046344 unclassified probably benign
R3797:Skida1 UTSW 2 18045897 nonsense probably null
R4521:Skida1 UTSW 2 18045872 unclassified probably benign
R5270:Skida1 UTSW 2 18047649 missense probably benign 0.03
R5467:Skida1 UTSW 2 18046112 unclassified probably benign
R5890:Skida1 UTSW 2 18046003 unclassified probably benign
R7181:Skida1 UTSW 2 18046791 missense unknown
R7398:Skida1 UTSW 2 18046272 missense unknown
R8103:Skida1 UTSW 2 18047738 missense probably benign 0.01
R8199:Skida1 UTSW 2 18048148 missense probably damaging 1.00
R9178:Skida1 UTSW 2 18045678 nonsense probably null
R9295:Skida1 UTSW 2 18046575 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCGTAGCAAATTCAGGACAATG -3'
(R):5'- AGTGTCAAAGCCGAGTCAC -3'

Sequencing Primer
(F):5'- ATTCAGGACAATGAGGGATTTTG -3'
(R):5'- TGTCAAAGCCGAGTCACCAGAG -3'
Posted On 2020-10-20