Incidental Mutation 'R8427:Strc'
ID653508
Institutional Source Beutler Lab
Gene Symbol Strc
Ensembl Gene ENSMUSG00000033498
Gene Namestereocilin
SynonymsDFNB16
MMRRC Submission
Accession Numbers

Genbank: NM_080459; MGI: 2153816

Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R8427 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location121363728-121387168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 121377531 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 453 (H453P)
Ref Sequence ENSEMBL: ENSMUSP00000039378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]
Predicted Effect probably damaging
Transcript: ENSMUST00000038389
AA Change: H453P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: H453P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 108 119 N/A INTRINSIC
low complexity region 132 161 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 376 425 N/A INTRINSIC
low complexity region 610 635 N/A INTRINSIC
low complexity region 656 677 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1168 1194 N/A INTRINSIC
low complexity region 1287 1302 N/A INTRINSIC
low complexity region 1560 1580 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129136
SMART Domains Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

DomainStartEndE-ValueType
low complexity region 26 49 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik G T 12: 72,903,286 S271R possibly damaging Het
Adrb2 A G 18: 62,179,274 V160A possibly damaging Het
Atp13a5 T C 16: 29,349,002 D113G possibly damaging Het
B4galt7 T A 13: 55,609,325 V312D possibly damaging Het
Bccip A G 7: 133,709,491 D45G probably benign Het
Bcl2l2 A G 14: 54,885,403 Y151C probably damaging Het
Ccdc146 T C 5: 21,399,792 E16G unknown Het
Cdr2l C A 11: 115,394,039 D400E probably damaging Het
Celsr2 A C 3: 108,392,633 *2920E probably null Het
Cib1 A G 7: 80,228,001 F183L probably damaging Het
Cnot1 A G 8: 95,734,324 Y1716H probably benign Het
Copb1 A G 7: 114,226,754 V665A probably benign Het
Crmp1 C T 5: 37,291,195 T683I probably damaging Het
Cubn G C 2: 13,428,756 F1114L probably benign Het
Dab2 A T 15: 6,429,359 R251* probably null Het
Ddx28 A G 8: 106,010,280 V382A probably benign Het
Eml1 C A 12: 108,530,321 T612K probably damaging Het
Hoxb3 CGGCGGTGGCGG CGGCGGTGGCGGTGGCGG 11: 96,345,589 probably benign Het
Hoxb3 TGGCGG TGGCGGAGGCGG 11: 96,345,595 probably benign Het
Iapp T A 6: 142,298,886 I13N probably damaging Het
Ifit1bl1 A T 19: 34,599,266 probably null Het
Itgb4 T A 11: 115,991,718 probably null Het
Kcnh3 T C 15: 99,227,053 V128A probably benign Het
Kmt2a A G 9: 44,845,423 F1176L probably damaging Het
Lifr A G 15: 7,190,981 T1031A probably benign Het
Lrp2 T C 2: 69,451,297 D3910G probably damaging Het
Man1a2 A T 3: 100,684,685 S60T probably benign Het
Mdh1 C T 11: 21,564,138 R93K probably benign Het
Mical1 G T 10: 41,478,595 K142N probably damaging Het
Nf2 T A 11: 4,791,118 E365D probably benign Het
Nfrkb A G 9: 31,419,027 M1192V probably benign Het
Npas4 A C 19: 4,986,080 D685E probably benign Het
Olfr1291-ps1 A G 2: 111,499,965 T238A probably damaging Het
Olfr358 G T 2: 37,004,782 Y277* probably null Het
Olfr747 T A 14: 50,681,149 I162F probably damaging Het
Ovch2 G A 7: 107,794,000 T222I probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pld1 A T 3: 28,088,646 I668F probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ppa1 A G 10: 61,660,925 D64G possibly damaging Het
Rnf133 T C 6: 23,649,406 I175V probably benign Het
Rpp30 A G 19: 36,094,412 I127V probably benign Het
Scube2 T A 7: 109,800,590 H913L probably damaging Het
Sema6d T A 2: 124,665,277 S1045T probably benign Het
Skida1 A T 2: 18,046,591 N496K unknown Het
Slc29a2 A T 19: 5,030,420 I397F probably benign Het
Slc38a2 G T 15: 96,692,413 R316S probably damaging Het
Slc40a1 A C 1: 45,912,338 Y220D probably damaging Het
Tmprss3 T A 17: 31,188,384 I312F probably damaging Het
Tnn G A 1: 160,130,686 T529I probably damaging Het
Tnr A T 1: 159,886,231 D743V possibly damaging Het
Trim42 A T 9: 97,363,121 F542Y probably benign Het
Trpm2 A T 10: 77,911,402 Y1421N possibly damaging Het
Ttn T C 2: 76,746,557 E24664G probably damaging Het
Ube2q2 T C 9: 55,184,966 probably null Het
Unc79 A T 12: 103,079,038 R824S probably benign Het
V1ra8 A G 6: 90,203,577 D254G probably damaging Het
Vmn1r173 A T 7: 23,702,534 I65F probably damaging Het
Vmn2r16 T A 5: 109,340,272 M337K probably benign Het
Wfs1 C A 5: 36,968,087 G487C probably damaging Het
Xdh T C 17: 73,935,931 Y127C probably damaging Het
Zfp229 T C 17: 21,746,834 S682P probably damaging Het
Zscan4-ps1 A T 7: 11,068,520 D117E possibly damaging Het
Other mutations in Strc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Strc APN 2 121365060 missense probably benign 0.39
IGL01152:Strc APN 2 121370795 missense probably benign
IGL01608:Strc APN 2 121375594 missense probably benign 0.05
IGL01695:Strc APN 2 121375298 missense probably damaging 1.00
IGL01715:Strc APN 2 121365737 splice site probably null
IGL01906:Strc APN 2 121377634 missense probably benign
IGL02135:Strc APN 2 121364834 missense probably damaging 1.00
IGL02416:Strc APN 2 121369058 missense probably damaging 1.00
IGL02455:Strc APN 2 121375791 unclassified probably benign
IGL03029:Strc APN 2 121364044 missense possibly damaging 0.95
IGL03176:Strc APN 2 121372180 missense probably damaging 0.99
IGL03272:Strc APN 2 121371751 missense probably damaging 1.00
3-1:Strc UTSW 2 121373680 missense probably damaging 0.99
IGL02799:Strc UTSW 2 121379236 missense probably damaging 1.00
PIT4283001:Strc UTSW 2 121375307 missense probably damaging 1.00
R0022:Strc UTSW 2 121368393 missense probably damaging 1.00
R0494:Strc UTSW 2 121379533 missense probably damaging 0.99
R1065:Strc UTSW 2 121366651 missense probably damaging 1.00
R1148:Strc UTSW 2 121372077 intron probably benign
R1148:Strc UTSW 2 121372077 intron probably benign
R1203:Strc UTSW 2 121372123 missense possibly damaging 0.66
R1343:Strc UTSW 2 121365115 missense probably benign 0.21
R1544:Strc UTSW 2 121372738 splice site probably null
R1650:Strc UTSW 2 121380885 start gained probably benign
R1840:Strc UTSW 2 121379296 missense probably damaging 1.00
R1983:Strc UTSW 2 121371037 missense possibly damaging 0.54
R2035:Strc UTSW 2 121374934 missense probably damaging 1.00
R2058:Strc UTSW 2 121378887 missense probably damaging 1.00
R2158:Strc UTSW 2 121365862 missense probably benign 0.10
R2219:Strc UTSW 2 121364523 missense probably damaging 1.00
R2680:Strc UTSW 2 121365111 missense probably damaging 0.99
R4375:Strc UTSW 2 121380823 missense unknown
R4563:Strc UTSW 2 121365805 missense probably benign 0.02
R4578:Strc UTSW 2 121378003 missense possibly damaging 0.94
R4607:Strc UTSW 2 121372945 missense probably benign 0.31
R4651:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4652:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4790:Strc UTSW 2 121375594 missense probably benign 0.05
R5480:Strc UTSW 2 121364819 missense probably benign 0.00
R5580:Strc UTSW 2 121375012 missense probably damaging 0.99
R5679:Strc UTSW 2 121368100 missense probably benign 0.03
R5703:Strc UTSW 2 121370814 missense probably benign
R5841:Strc UTSW 2 121365877 missense probably benign 0.29
R5917:Strc UTSW 2 121379309 missense probably benign
R5958:Strc UTSW 2 121376922 missense possibly damaging 0.56
R6320:Strc UTSW 2 121374958 missense probably benign 0.16
R6619:Strc UTSW 2 121368432 missense probably damaging 0.99
R6695:Strc UTSW 2 121377224 missense probably benign 0.35
R6970:Strc UTSW 2 121378014 missense probably benign 0.41
R7018:Strc UTSW 2 121369058 missense probably damaging 1.00
R7045:Strc UTSW 2 121370726 missense probably damaging 1.00
R7190:Strc UTSW 2 121369026 missense probably benign 0.14
R7283:Strc UTSW 2 121379452 missense probably damaging 0.99
R7694:Strc UTSW 2 121377096 missense probably damaging 1.00
R7699:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7700:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7756:Strc UTSW 2 121370946 missense probably benign
R7758:Strc UTSW 2 121370946 missense probably benign
R7822:Strc UTSW 2 121377738 missense probably benign 0.01
R7830:Strc UTSW 2 121375049 missense probably damaging 0.99
R7953:Strc UTSW 2 121377363 missense probably damaging 0.99
R8137:Strc UTSW 2 121366738 missense probably damaging 0.98
R8394:Strc UTSW 2 121379009 missense probably benign 0.00
Z1176:Strc UTSW 2 121375521 missense probably damaging 0.98
Z1176:Strc UTSW 2 121379044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATTCTCCAGGAAACAGCC -3'
(R):5'- TGCCAGCACATCAAGCCTG -3'

Sequencing Primer
(F):5'- GGAAACAGCCCCAGAATATTTC -3'
(R):5'- TCAAGCCTGCCACCCCG -3'
Posted On2020-10-20