Mutagenetix > Incidental Mutation

Incidental Mutation 'R8427:Celsr2'

653512

Institutional Source

Beutler Lab

Gene Symbol

Celsr2

Ensembl Gene

ENSMUSG00000068740

Gene Name

cadherin, EGF LAG seven-pass G-type receptor 2

Synonyms

mfmi1, EGFL2, flamingo

MMRRC Submission

Accession Numbers

Genbank: NM_017392.3, NM_001004177.2 ; Ensembl: ENSMUST00000090558

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8427 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

108390851-108415552 bp(-) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

A to C at 108392633 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Glutamic Acid at position 2920 (*2920E)

Ref Sequence

ENSEMBL: ENSMUSP00000088046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090558] [ENSMUST00000090561] [ENSMUST00000102629]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000090558
AA Change: *2920E

SMART Domains

Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: *2920E

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
low complexity region	35	53	N/A	INTRINSIC
CA	203	287	1.36e-26	SMART
CA	311	397	1.33e-29	SMART
CA	421	503	2.59e-27	SMART
CA	527	608	3.33e-30	SMART
CA	632	710	5.18e-18	SMART
CA	734	813	1.08e-29	SMART
CA	837	919	8.08e-29	SMART
low complexity region	920	932	N/A	INTRINSIC
CA	943	1021	4.3e-24	SMART
CA	1049	1125	1.87e-1	SMART
low complexity region	1188	1198	N/A	INTRINSIC
EGF	1231	1286	1.81e-3	SMART
EGF_CA	1288	1324	2.24e-8	SMART
EGF	1331	1366	6.65e-2	SMART
LamG	1387	1554	8.4e-30	SMART
EGF	1577	1610	8e-5	SMART
LamG	1636	1770	1.56e-24	SMART
EGF	1796	1829	2.35e-2	SMART
EGF	1831	1867	3.88e-3	SMART
TNFR	1908	1943	1.35e-1	SMART
EGF_Lam	1924	1969	9.54e-12	SMART
HormR	1972	2034	1.57e-20	SMART
Pfam:GAIN	2046	2289	3e-62	PFAM
GPS	2315	2368	1.86e-25	SMART
Pfam:7tm_2	2373	2605	1.1e-48	PFAM
low complexity region	2715	2733	N/A	INTRINSIC
low complexity region	2857	2873	N/A	INTRINSIC
low complexity region	2874	2881	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000090561

SMART Domains

Protein: ENSMUSP00000088049
Gene: ENSMUSG00000068744

Domain	Start	End	E-Value	Type
Pfam:GTSE1_N	7	124	4.8e-24	PFAM
low complexity region	131	143	N/A	INTRINSIC
low complexity region	222	231	N/A	INTRINSIC
low complexity region	300	316	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102629

SMART Domains

Protein: ENSMUSP00000099689
Gene: ENSMUSG00000068744

Domain	Start	End	E-Value	Type
Pfam:GTSE1_N	8	108	2e-12	PFAM
low complexity region	131	143	N/A	INTRINSIC
low complexity region	222	231	N/A	INTRINSIC
low complexity region	300	316	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147251

SMART Domains

Protein: ENSMUSP00000122329
Gene: ENSMUSG00000068740

Domain	Start	End	E-Value	Type
Pfam:GAIN	35	278	5.1e-63	PFAM
GPS	304	357	1.86e-25	SMART
Pfam:7tm_2	362	594	2e-49	PFAM
low complexity region	704	722	N/A	INTRINSIC
low complexity region	846	862	N/A	INTRINSIC
low complexity region	863	870	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447C04Rik	G	T	12: 72,903,286	S271R	possibly damaging	Het
Adrb2	A	G	18: 62,179,274	V160A	possibly damaging	Het
Atp13a5	T	C	16: 29,349,002	D113G	possibly damaging	Het
B4galt7	T	A	13: 55,609,325	V312D	possibly damaging	Het
Bccip	A	G	7: 133,709,491	D45G	probably benign	Het
Bcl2l2	A	G	14: 54,885,403	Y151C	probably damaging	Het
Ccdc146	T	C	5: 21,399,792	E16G	unknown	Het
Cdr2l	C	A	11: 115,394,039	D400E	probably damaging	Het
Cib1	A	G	7: 80,228,001	F183L	probably damaging	Het
Cnot1	A	G	8: 95,734,324	Y1716H	probably benign	Het
Copb1	A	G	7: 114,226,754	V665A	probably benign	Het
Crmp1	C	T	5: 37,291,195	T683I	probably damaging	Het
Cubn	G	C	2: 13,428,756	F1114L	probably benign	Het
Dab2	A	T	15: 6,429,359	R251*	probably null	Het
Ddx28	A	G	8: 106,010,280	V382A	probably benign	Het
Eml1	C	A	12: 108,530,321	T612K	probably damaging	Het
Hoxb3	CGGCGGTGGCGG	CGGCGGTGGCGGTGGCGG	11: 96,345,589		probably benign	Het
Hoxb3	TGGCGG	TGGCGGAGGCGG	11: 96,345,595		probably benign	Het
Iapp	T	A	6: 142,298,886	I13N	probably damaging	Het
Ifit1bl1	A	T	19: 34,599,266		probably null	Het
Itgb4	T	A	11: 115,991,718		probably null	Het
Kcnh3	T	C	15: 99,227,053	V128A	probably benign	Het
Kmt2a	A	G	9: 44,845,423	F1176L	probably damaging	Het
Lifr	A	G	15: 7,190,981	T1031A	probably benign	Het
Lrp2	T	C	2: 69,451,297	D3910G	probably damaging	Het
Man1a2	A	T	3: 100,684,685	S60T	probably benign	Het
Mdh1	C	T	11: 21,564,138	R93K	probably benign	Het
Mical1	G	T	10: 41,478,595	K142N	probably damaging	Het
Nf2	T	A	11: 4,791,118	E365D	probably benign	Het
Nfrkb	A	G	9: 31,419,027	M1192V	probably benign	Het
Npas4	A	C	19: 4,986,080	D685E	probably benign	Het
Olfr1291-ps1	A	G	2: 111,499,965	T238A	probably damaging	Het
Olfr358	G	T	2: 37,004,782	Y277*	probably null	Het
Olfr747	T	A	14: 50,681,149	I162F	probably damaging	Het
Ovch2	G	A	7: 107,794,000	T222I	probably damaging	Het
Plat	G	T	8: 22,772,232	G91W	probably damaging	Het
Pld1	A	T	3: 28,088,646	I668F	probably damaging	Het
Plscr4	C	T	9: 92,490,790	R322*	probably null	Het
Ppa1	A	G	10: 61,660,925	D64G	possibly damaging	Het
Rnf133	T	C	6: 23,649,406	I175V	probably benign	Het
Rpp30	A	G	19: 36,094,412	I127V	probably benign	Het
Scube2	T	A	7: 109,800,590	H913L	probably damaging	Het
Sema6d	T	A	2: 124,665,277	S1045T	probably benign	Het
Skida1	A	T	2: 18,046,591	N496K	unknown	Het
Slc29a2	A	T	19: 5,030,420	I397F	probably benign	Het
Slc38a2	G	T	15: 96,692,413	R316S	probably damaging	Het
Slc40a1	A	C	1: 45,912,338	Y220D	probably damaging	Het
Strc	T	G	2: 121,377,531	H453P	probably damaging	Het
Tmprss3	T	A	17: 31,188,384	I312F	probably damaging	Het
Tnn	G	A	1: 160,130,686	T529I	probably damaging	Het
Tnr	A	T	1: 159,886,231	D743V	possibly damaging	Het
Trim42	A	T	9: 97,363,121	F542Y	probably benign	Het
Trpm2	A	T	10: 77,911,402	Y1421N	possibly damaging	Het
Ttn	T	C	2: 76,746,557	E24664G	probably damaging	Het
Ube2q2	T	C	9: 55,184,966		probably null	Het
Unc79	A	T	12: 103,079,038	R824S	probably benign	Het
V1ra8	A	G	6: 90,203,577	D254G	probably damaging	Het
Vmn1r173	A	T	7: 23,702,534	I65F	probably damaging	Het
Vmn2r16	T	A	5: 109,340,272	M337K	probably benign	Het
Wfs1	C	A	5: 36,968,087	G487C	probably damaging	Het
Xdh	T	C	17: 73,935,931	Y127C	probably damaging	Het
Zfp229	T	C	17: 21,746,834	S682P	probably damaging	Het
Zscan4-ps1	A	T	7: 11,068,520	D117E	possibly damaging	Het

Other mutations in Celsr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Celsr2	APN	3	108413879	missense	possibly damaging	0.49
IGL01020:Celsr2	APN	3	108403270	missense	probably damaging	0.99
IGL01420:Celsr2	APN	3	108393763	missense	probably benign	0.13
IGL01448:Celsr2	APN	3	108393239	missense	probably damaging	0.99
IGL01559:Celsr2	APN	3	108406867	missense	possibly damaging	0.75
IGL01674:Celsr2	APN	3	108414843	missense	probably damaging	1.00
IGL01863:Celsr2	APN	3	108394022	missense	probably benign	0.00
IGL02309:Celsr2	APN	3	108396011	missense	probably damaging	1.00
IGL02325:Celsr2	APN	3	108412871	missense	probably damaging	1.00
IGL02409:Celsr2	APN	3	108413955	missense	probably damaging	1.00
IGL02514:Celsr2	APN	3	108397510	missense	probably benign	0.01
IGL02812:Celsr2	APN	3	108414113	missense	probably benign	0.25
IGL02894:Celsr2	APN	3	108395210	missense	probably damaging	1.00
IGL03281:Celsr2	APN	3	108412940	missense	probably damaging	1.00
barrow	UTSW	3	108394965	missense	possibly damaging	0.92
goldeneye	UTSW	3	108394919	missense	probably damaging	1.00
1mM(1):Celsr2	UTSW	3	108400838	missense	probably benign	0.01
ANU74:Celsr2	UTSW	3	108412499	missense	probably damaging	1.00
IGL02799:Celsr2	UTSW	3	108414062	missense	probably damaging	1.00
R0011:Celsr2	UTSW	3	108413402	missense	probably benign	0.19
R0031:Celsr2	UTSW	3	108413063	missense	probably damaging	1.00
R0049:Celsr2	UTSW	3	108397254	missense	probably benign	0.12
R0049:Celsr2	UTSW	3	108397254	missense	probably benign	0.12
R0090:Celsr2	UTSW	3	108393327	splice site	probably benign
R0140:Celsr2	UTSW	3	108397933	missense	probably benign	0.00
R0524:Celsr2	UTSW	3	108401587	missense	probably damaging	1.00
R0607:Celsr2	UTSW	3	108403895	critical splice donor site	probably null
R0662:Celsr2	UTSW	3	108398520	missense	probably damaging	0.99
R0690:Celsr2	UTSW	3	108414977	missense	probably damaging	1.00
R0691:Celsr2	UTSW	3	108412623	missense	probably damaging	1.00
R0710:Celsr2	UTSW	3	108412712	missense	probably benign	0.42
R0730:Celsr2	UTSW	3	108398606	missense	probably damaging	1.00
R0815:Celsr2	UTSW	3	108401301	missense	possibly damaging	0.56
R0848:Celsr2	UTSW	3	108414338	missense	probably benign
R0989:Celsr2	UTSW	3	108403272	missense	probably benign	0.00
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1469:Celsr2	UTSW	3	108414108	missense	probably damaging	1.00
R1469:Celsr2	UTSW	3	108414108	missense	probably damaging	1.00
R1474:Celsr2	UTSW	3	108393739	missense	possibly damaging	0.91
R1608:Celsr2	UTSW	3	108402483	missense	probably damaging	1.00
R1653:Celsr2	UTSW	3	108413520	missense	possibly damaging	0.52
R1659:Celsr2	UTSW	3	108414095	missense	probably benign
R1689:Celsr2	UTSW	3	108407304	missense	possibly damaging	0.63
R1848:Celsr2	UTSW	3	108401310	missense	probably benign	0.35
R1859:Celsr2	UTSW	3	108396630	missense	probably damaging	1.00
R1918:Celsr2	UTSW	3	108398650	missense	probably benign	0.05
R1974:Celsr2	UTSW	3	108414214	missense	probably damaging	1.00
R2042:Celsr2	UTSW	3	108402495	missense	probably damaging	0.98
R2167:Celsr2	UTSW	3	108413193	missense	probably damaging	0.96
R2333:Celsr2	UTSW	3	108398605	missense	probably benign	0.16
R2434:Celsr2	UTSW	3	108404479	missense	probably damaging	1.00
R2504:Celsr2	UTSW	3	108413591	missense	probably benign	0.11
R3420:Celsr2	UTSW	3	108414416	missense	probably benign	0.03
R3712:Celsr2	UTSW	3	108400839	missense	probably benign
R3723:Celsr2	UTSW	3	108397415	splice site	probably benign
R3809:Celsr2	UTSW	3	108403239	missense	possibly damaging	0.67
R4018:Celsr2	UTSW	3	108394965	missense	possibly damaging	0.92
R4126:Celsr2	UTSW	3	108402097	missense	possibly damaging	0.71
R4177:Celsr2	UTSW	3	108413978	missense	probably damaging	0.96
R4232:Celsr2	UTSW	3	108413772	missense	probably benign	0.02
R4293:Celsr2	UTSW	3	108393677	missense	probably benign	0.01
R4458:Celsr2	UTSW	3	108394997	missense	probably damaging	0.98
R4621:Celsr2	UTSW	3	108395216	missense	possibly damaging	0.86
R4645:Celsr2	UTSW	3	108395969	missense	probably damaging	1.00
R4700:Celsr2	UTSW	3	108397231	missense	probably benign	0.24
R4732:Celsr2	UTSW	3	108398952	missense	probably damaging	0.99
R4733:Celsr2	UTSW	3	108398952	missense	probably damaging	0.99
R4901:Celsr2	UTSW	3	108406987	missense	possibly damaging	0.81
R4932:Celsr2	UTSW	3	108402758	missense	probably damaging	1.00
R4989:Celsr2	UTSW	3	108412629	missense	possibly damaging	0.62
R5052:Celsr2	UTSW	3	108412358	missense	probably damaging	1.00
R5093:Celsr2	UTSW	3	108413373	missense	possibly damaging	0.66
R5114:Celsr2	UTSW	3	108393996	missense	probably benign	0.05
R5120:Celsr2	UTSW	3	108393120	missense	probably benign	0.02
R5135:Celsr2	UTSW	3	108398659	missense	probably damaging	1.00
R5247:Celsr2	UTSW	3	108397630	missense	probably benign	0.34
R5381:Celsr2	UTSW	3	108402757	missense	probably damaging	1.00
R5412:Celsr2	UTSW	3	108399995	missense	probably damaging	1.00
R5445:Celsr2	UTSW	3	108392658	missense	probably benign	0.01
R5528:Celsr2	UTSW	3	108413294	missense	probably damaging	1.00
R5598:Celsr2	UTSW	3	108402803	missense	possibly damaging	0.82
R5652:Celsr2	UTSW	3	108396735	missense	probably null	0.49
R5697:Celsr2	UTSW	3	108403921	nonsense	probably null
R5718:Celsr2	UTSW	3	108393358	missense	probably benign
R5869:Celsr2	UTSW	3	108413909	missense	probably damaging	1.00
R5876:Celsr2	UTSW	3	108413943	missense	probably damaging	0.96
R6021:Celsr2	UTSW	3	108401245	missense	probably benign
R6054:Celsr2	UTSW	3	108406963	missense	possibly damaging	0.95
R6244:Celsr2	UTSW	3	108393128	missense	probably damaging	0.96
R6313:Celsr2	UTSW	3	108401214	missense	probably damaging	0.99
R6322:Celsr2	UTSW	3	108412574	missense	probably damaging	1.00
R6555:Celsr2	UTSW	3	108394919	missense	probably damaging	1.00
R6682:Celsr2	UTSW	3	108400501	critical splice donor site	probably null
R7062:Celsr2	UTSW	3	108402510	missense	possibly damaging	0.95
R7110:Celsr2	UTSW	3	108397865	missense	probably damaging	1.00
R7139:Celsr2	UTSW	3	108415359	missense	unknown
R7326:Celsr2	UTSW	3	108394995	missense	possibly damaging	0.85
R7425:Celsr2	UTSW	3	108402457	missense	probably damaging	1.00
R7452:Celsr2	UTSW	3	108413090	missense	possibly damaging	0.95
R7461:Celsr2	UTSW	3	108395640	missense	probably damaging	1.00
R7502:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R7613:Celsr2	UTSW	3	108395640	missense	probably damaging	1.00
R7644:Celsr2	UTSW	3	108413490	missense	probably damaging	0.99
R7666:Celsr2	UTSW	3	108398588	missense	probably benign
R7687:Celsr2	UTSW	3	108397769	missense	probably benign	0.27
R7695:Celsr2	UTSW	3	108402753	missense	probably damaging	1.00
R8002:Celsr2	UTSW	3	108403969	missense	probably damaging	1.00
R8052:Celsr2	UTSW	3	108412655	missense	probably damaging	1.00
R8283:Celsr2	UTSW	3	108396455	missense	probably damaging	1.00
R8356:Celsr2	UTSW	3	108413531	missense	possibly damaging	0.90
R8381:Celsr2	UTSW	3	108395636	missense	probably damaging	1.00
R8435:Celsr2	UTSW	3	108414399	missense	probably benign
R8438:Celsr2	UTSW	3	108393823	missense	probably damaging	1.00
R8458:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8460:Celsr2	UTSW	3	108396777	missense	possibly damaging	0.84
R8462:Celsr2	UTSW	3	108412851	nonsense	probably null
R8479:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8480:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8512:Celsr2	UTSW	3	108413838	missense	probably damaging	1.00
R8694:Celsr2	UTSW	3	108406860	missense	probably damaging	1.00
R8772:Celsr2	UTSW	3	108397073	missense	possibly damaging	0.84
R8843:Celsr2	UTSW	3	108396127	splice site	probably benign
R8888:Celsr2	UTSW	3	108413564	missense	possibly damaging	0.95
R8895:Celsr2	UTSW	3	108413564	missense	possibly damaging	0.95
R8917:Celsr2	UTSW	3	108396566	missense	probably benign	0.00
R9119:Celsr2	UTSW	3	108401972	missense	possibly damaging	0.90
R9169:Celsr2	UTSW	3	108402546	missense	probably benign	0.04
R9209:Celsr2	UTSW	3	108414033	missense	probably benign	0.02
R9342:Celsr2	UTSW	3	108413126	missense	probably damaging	1.00
R9416:Celsr2	UTSW	3	108414768	missense	probably damaging	0.96
R9493:Celsr2	UTSW	3	108393758	missense	probably damaging	1.00
R9564:Celsr2	UTSW	3	108414518	missense	probably damaging	1.00
R9598:Celsr2	UTSW	3	108415262	missense	possibly damaging	0.72
R9629:Celsr2	UTSW	3	108401599	missense	probably damaging	1.00
R9691:Celsr2	UTSW	3	108394235	missense	probably damaging	1.00
X0020:Celsr2	UTSW	3	108396110	missense	probably damaging	1.00
X0050:Celsr2	UTSW	3	108401272	missense	probably benign	0.09
Z1088:Celsr2	UTSW	3	108414117	missense	probably damaging	1.00
Z1176:Celsr2	UTSW	3	108393131	missense	probably benign	0.10
Z1176:Celsr2	UTSW	3	108412341	missense	probably benign	0.07
Z1177:Celsr2	UTSW	3	108412220	missense	probably damaging	1.00
Z1177:Celsr2	UTSW	3	108413571	missense	probably benign	0.32
Z1191:Celsr2	UTSW	3	108414549	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- AGGGACTTGGCACTAGTTGG -3'
(R):5'- GACAACATGGTGCTCTGTTGGG -3'

Sequencing Primer
(F):5'- GCACTAGTTGGCCTTCTGG -3'
(R):5'- GGCTTTATGCGCAATGCC -3'

Posted On

2020-10-20