Incidental Mutation 'R8427:Wfs1'
ID 653514
Institutional Source Beutler Lab
Gene Symbol Wfs1
Ensembl Gene ENSMUSG00000039474
Gene Name wolframin ER transmembrane glycoprotein
Synonyms wolframin
MMRRC Submission
Accession Numbers

Genbank: NM_011716; MGI: 1328355

Is this an essential gene? Possibly non essential (E-score: 0.472) question?
Stock # R8427 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 36966104-36989205 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 36968087 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 487 (G487C)
Ref Sequence ENSEMBL: ENSMUSP00000048053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043964] [ENSMUST00000166339]
AlphaFold P56695
Predicted Effect probably damaging
Transcript: ENSMUST00000043964
AA Change: G487C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048053
Gene: ENSMUSG00000039474
AA Change: G487C

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
low complexity region 50 67 N/A INTRINSIC
Blast:SEL1 101 139 1e-8 BLAST
low complexity region 268 275 N/A INTRINSIC
transmembrane domain 313 335 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
transmembrane domain 407 424 N/A INTRINSIC
transmembrane domain 431 453 N/A INTRINSIC
transmembrane domain 495 517 N/A INTRINSIC
transmembrane domain 529 551 N/A INTRINSIC
transmembrane domain 561 583 N/A INTRINSIC
transmembrane domain 590 612 N/A INTRINSIC
transmembrane domain 632 654 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166339
AA Change: G411C

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132404
Gene: ENSMUSG00000039474
AA Change: G411C

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
low complexity region 50 67 N/A INTRINSIC
Blast:SEL1 101 139 3e-8 BLAST
low complexity region 268 275 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
transmembrane domain 419 441 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
transmembrane domain 556 578 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167937
SMART Domains Protein: ENSMUSP00000125779
Gene: ENSMUSG00000039474

DomainStartEndE-ValueType
Blast:SEL1 20 58 4e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein, which is located primarily in the endoplasmic reticulum and ubiquitously expressed with highest levels in brain, pancreas, heart, and insulinoma beta-cell lines. Mutations in this gene are associated with Wolfram syndrome, also called DIDMOAD (Diabetes Insipidus, Diabetes Mellitus, Optic Atrophy, and Deafness), an autosomal recessive disorder. The disease affects the brain and central nervous system. Mutations in this gene can also cause autosomal dominant deafness 6 (DFNA6), also known as DFNA14 or DFNA38. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased pancreatic beta cells and impaired glucose tolerance. Mice homozygous for a knock-out allele exhibit impaired glucose tolerance, decreased body weight, and abnormal behavior associated with increased sensitivity to stress. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik G T 12: 72,903,286 S271R possibly damaging Het
Adrb2 A G 18: 62,179,274 V160A possibly damaging Het
Atp13a5 T C 16: 29,349,002 D113G possibly damaging Het
B4galt7 T A 13: 55,609,325 V312D possibly damaging Het
Bccip A G 7: 133,709,491 D45G probably benign Het
Bcl2l2 A G 14: 54,885,403 Y151C probably damaging Het
Ccdc146 T C 5: 21,399,792 E16G unknown Het
Cdr2l C A 11: 115,394,039 D400E probably damaging Het
Celsr2 A C 3: 108,392,633 *2920E probably null Het
Cib1 A G 7: 80,228,001 F183L probably damaging Het
Cnot1 A G 8: 95,734,324 Y1716H probably benign Het
Copb1 A G 7: 114,226,754 V665A probably benign Het
Crmp1 C T 5: 37,291,195 T683I probably damaging Het
Cubn G C 2: 13,428,756 F1114L probably benign Het
Dab2 A T 15: 6,429,359 R251* probably null Het
Ddx28 A G 8: 106,010,280 V382A probably benign Het
Eml1 C A 12: 108,530,321 T612K probably damaging Het
Hoxb3 CGGCGGTGGCGG CGGCGGTGGCGGTGGCGG 11: 96,345,589 probably benign Het
Hoxb3 TGGCGG TGGCGGAGGCGG 11: 96,345,595 probably benign Het
Iapp T A 6: 142,298,886 I13N probably damaging Het
Ifit1bl1 A T 19: 34,599,266 probably null Het
Itgb4 T A 11: 115,991,718 probably null Het
Kcnh3 T C 15: 99,227,053 V128A probably benign Het
Kmt2a A G 9: 44,845,423 F1176L probably damaging Het
Lifr A G 15: 7,190,981 T1031A probably benign Het
Lrp2 T C 2: 69,451,297 D3910G probably damaging Het
Man1a2 A T 3: 100,684,685 S60T probably benign Het
Mdh1 C T 11: 21,564,138 R93K probably benign Het
Mical1 G T 10: 41,478,595 K142N probably damaging Het
Nf2 T A 11: 4,791,118 E365D probably benign Het
Nfrkb A G 9: 31,419,027 M1192V probably benign Het
Npas4 A C 19: 4,986,080 D685E probably benign Het
Olfr1291-ps1 A G 2: 111,499,965 T238A probably damaging Het
Olfr358 G T 2: 37,004,782 Y277* probably null Het
Olfr747 T A 14: 50,681,149 I162F probably damaging Het
Ovch2 G A 7: 107,794,000 T222I probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pld1 A T 3: 28,088,646 I668F probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ppa1 A G 10: 61,660,925 D64G possibly damaging Het
Rnf133 T C 6: 23,649,406 I175V probably benign Het
Rpp30 A G 19: 36,094,412 I127V probably benign Het
Scube2 T A 7: 109,800,590 H913L probably damaging Het
Sema6d T A 2: 124,665,277 S1045T probably benign Het
Skida1 A T 2: 18,046,591 N496K unknown Het
Slc29a2 A T 19: 5,030,420 I397F probably benign Het
Slc38a2 G T 15: 96,692,413 R316S probably damaging Het
Slc40a1 A C 1: 45,912,338 Y220D probably damaging Het
Strc T G 2: 121,377,531 H453P probably damaging Het
Tmprss3 T A 17: 31,188,384 I312F probably damaging Het
Tnn G A 1: 160,130,686 T529I probably damaging Het
Tnr A T 1: 159,886,231 D743V possibly damaging Het
Trim42 A T 9: 97,363,121 F542Y probably benign Het
Trpm2 A T 10: 77,911,402 Y1421N possibly damaging Het
Ttn T C 2: 76,746,557 E24664G probably damaging Het
Ube2q2 T C 9: 55,184,966 probably null Het
Unc79 A T 12: 103,079,038 R824S probably benign Het
V1ra8 A G 6: 90,203,577 D254G probably damaging Het
Vmn1r173 A T 7: 23,702,534 I65F probably damaging Het
Vmn2r16 T A 5: 109,340,272 M337K probably benign Het
Xdh T C 17: 73,935,931 Y127C probably damaging Het
Zfp229 T C 17: 21,746,834 S682P probably damaging Het
Zscan4-ps1 A T 7: 11,068,520 D117E possibly damaging Het
Other mutations in Wfs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Wfs1 APN 5 36967917 nonsense probably null
IGL01391:Wfs1 APN 5 36971563 missense probably benign 0.10
IGL01788:Wfs1 APN 5 36968636 missense probably benign 0.01
IGL02169:Wfs1 APN 5 36968479 missense probably damaging 0.99
IGL02814:Wfs1 APN 5 36967669 missense possibly damaging 0.88
IGL03294:Wfs1 APN 5 36975597 missense probably damaging 1.00
IGL03299:Wfs1 APN 5 36968387 nonsense probably null
2107:Wfs1 UTSW 5 36967273 missense probably damaging 1.00
R0077:Wfs1 UTSW 5 36973194 missense probably damaging 1.00
R0180:Wfs1 UTSW 5 36967028 missense probably damaging 0.96
R0402:Wfs1 UTSW 5 36976980 unclassified probably benign
R0458:Wfs1 UTSW 5 36968669 missense probably damaging 0.98
R0533:Wfs1 UTSW 5 36973722 splice site probably benign
R0890:Wfs1 UTSW 5 36975544 missense probably damaging 1.00
R0948:Wfs1 UTSW 5 36967561 missense probably damaging 1.00
R1413:Wfs1 UTSW 5 36982078 missense possibly damaging 0.65
R1759:Wfs1 UTSW 5 36967015 missense probably damaging 0.99
R2009:Wfs1 UTSW 5 36968309 missense probably damaging 0.96
R2137:Wfs1 UTSW 5 36967501 missense probably damaging 0.99
R2157:Wfs1 UTSW 5 36967942 missense probably damaging 1.00
R2216:Wfs1 UTSW 5 36967220 nonsense probably null
R3779:Wfs1 UTSW 5 36968624 missense probably benign 0.01
R3850:Wfs1 UTSW 5 36968624 missense probably benign 0.01
R3853:Wfs1 UTSW 5 36968624 missense probably benign 0.01
R3918:Wfs1 UTSW 5 36968624 missense probably benign 0.01
R4093:Wfs1 UTSW 5 36967465 missense probably damaging 0.97
R5056:Wfs1 UTSW 5 36975587 missense probably benign 0.00
R5849:Wfs1 UTSW 5 36973264 missense probably damaging 1.00
R5997:Wfs1 UTSW 5 36967750 missense probably damaging 0.99
R6666:Wfs1 UTSW 5 36967619 missense possibly damaging 0.94
R7024:Wfs1 UTSW 5 36966950 missense probably damaging 1.00
R7157:Wfs1 UTSW 5 36967172 missense probably benign 0.00
R7264:Wfs1 UTSW 5 36967846 missense probably damaging 1.00
R7269:Wfs1 UTSW 5 36967790 nonsense probably null
R7365:Wfs1 UTSW 5 36967732 missense probably benign 0.33
R7657:Wfs1 UTSW 5 36968234 missense probably benign 0.01
R8422:Wfs1 UTSW 5 36973875 missense probably benign 0.17
R8446:Wfs1 UTSW 5 36971609 missense probably benign 0.00
R8949:Wfs1 UTSW 5 36966943 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACCACGGACAGTTCACAC -3'
(R):5'- TGGAGCCCTACATCCACTTC -3'

Sequencing Primer
(F):5'- GGACAGTTCACACCACATGAAG -3'
(R):5'- ACATCCACTTCCTACTGTCAGTCG -3'
Posted On 2020-10-20