Incidental Mutation 'R8427:Scube2'
ID 653524
Institutional Source Beutler Lab
Gene Symbol Scube2
Ensembl Gene ENSMUSG00000007279
Gene Name signal peptide, CUB domain, EGF-like 2
Synonyms ICRFP703B1614Q5.1, Cegf1, ICRFP703N2430Q5.1, 4932442O19Rik
MMRRC Submission 067821-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.527) question?
Stock # R8427 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 109397897-109464886 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 109399797 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 913 (H913L)
Ref Sequence ENSEMBL: ENSMUSP00000102340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007423] [ENSMUST00000106728] [ENSMUST00000106729]
AlphaFold Q9JJS0
Predicted Effect probably damaging
Transcript: ENSMUST00000007423
AA Change: H942L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007423
Gene: ENSMUSG00000007279
AA Change: H942L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 479 490 N/A INTRINSIC
low complexity region 577 594 N/A INTRINSIC
Pfam:GCC2_GCC3 642 692 7.2e-19 PFAM
Pfam:GCC2_GCC3 699 746 2e-16 PFAM
Pfam:GCC2_GCC3 755 802 3.1e-18 PFAM
CUB 807 919 1.23e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106728
AA Change: H750L

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102339
Gene: ENSMUSG00000007279
AA Change: H750L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 451 468 N/A INTRINSIC
Pfam:GCC2_GCC3 516 566 6.4e-17 PFAM
Pfam:GCC2_GCC3 573 620 3.5e-14 PFAM
Pfam:GCC2_GCC3 629 676 5.4e-16 PFAM
Blast:CUB 678 727 2e-25 BLAST
Blast:CUB 730 796 1e-37 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000106729
AA Change: H913L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102340
Gene: ENSMUSG00000007279
AA Change: H913L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 605 622 N/A INTRINSIC
Pfam:GCC2_GCC3 670 717 1.8e-16 PFAM
Pfam:GCC2_GCC3 726 773 2.7e-18 PFAM
CUB 778 890 1.23e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are smaller than controls. Mice also exhibit defective endochondral bone formation and impaired Ihh-mediated chondrocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik G T 12: 72,950,060 (GRCm39) S271R possibly damaging Het
Adrb2 A G 18: 62,312,345 (GRCm39) V160A possibly damaging Het
Atp13a5 T C 16: 29,167,820 (GRCm39) D113G possibly damaging Het
B4galt7 T A 13: 55,757,138 (GRCm39) V312D possibly damaging Het
Bccip A G 7: 133,311,220 (GRCm39) D45G probably benign Het
Bcl2l2 A G 14: 55,122,860 (GRCm39) Y151C probably damaging Het
Ccdc146 T C 5: 21,604,790 (GRCm39) E16G unknown Het
Cdr2l C A 11: 115,284,865 (GRCm39) D400E probably damaging Het
Celsr2 A C 3: 108,299,949 (GRCm39) *2920E probably null Het
Cib1 A G 7: 79,877,749 (GRCm39) F183L probably damaging Het
Cnot1 A G 8: 96,460,952 (GRCm39) Y1716H probably benign Het
Copb1 A G 7: 113,825,989 (GRCm39) V665A probably benign Het
Crmp1 C T 5: 37,448,539 (GRCm39) T683I probably damaging Het
Cubn G C 2: 13,433,567 (GRCm39) F1114L probably benign Het
Dab2 A T 15: 6,458,840 (GRCm39) R251* probably null Het
Ddx28 A G 8: 106,736,912 (GRCm39) V382A probably benign Het
Eml1 C A 12: 108,496,580 (GRCm39) T612K probably damaging Het
Hoxb3 CGGCGGTGGCGG CGGCGGTGGCGGTGGCGG 11: 96,236,415 (GRCm39) probably benign Het
Hoxb3 TGGCGG TGGCGGAGGCGG 11: 96,236,421 (GRCm39) probably benign Het
Iapp T A 6: 142,244,612 (GRCm39) I13N probably damaging Het
Ifit1bl1 A T 19: 34,576,666 (GRCm39) probably null Het
Itgb4 T A 11: 115,882,544 (GRCm39) probably null Het
Kcnh3 T C 15: 99,124,934 (GRCm39) V128A probably benign Het
Kmt2a A G 9: 44,756,720 (GRCm39) F1176L probably damaging Het
Lifr A G 15: 7,220,462 (GRCm39) T1031A probably benign Het
Lrp2 T C 2: 69,281,641 (GRCm39) D3910G probably damaging Het
Man1a2 A T 3: 100,592,001 (GRCm39) S60T probably benign Het
Mdh1 C T 11: 21,514,138 (GRCm39) R93K probably benign Het
Mical1 G T 10: 41,354,591 (GRCm39) K142N probably damaging Het
Nf2 T A 11: 4,741,118 (GRCm39) E365D probably benign Het
Nfrkb A G 9: 31,330,323 (GRCm39) M1192V probably benign Het
Npas4 A C 19: 5,036,108 (GRCm39) D685E probably benign Het
Or11h4b T A 14: 50,918,606 (GRCm39) I162F probably damaging Het
Or12k5 G T 2: 36,894,794 (GRCm39) Y277* probably null Het
Or4f4-ps1 A G 2: 111,330,310 (GRCm39) T238A probably damaging Het
Ovch2 G A 7: 107,393,207 (GRCm39) T222I probably damaging Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Pld1 A T 3: 28,142,795 (GRCm39) I668F probably damaging Het
Plscr4 C T 9: 92,372,843 (GRCm39) R322* probably null Het
Ppa1 A G 10: 61,496,704 (GRCm39) D64G possibly damaging Het
Rnf133 T C 6: 23,649,405 (GRCm39) I175V probably benign Het
Rpp30 A G 19: 36,071,812 (GRCm39) I127V probably benign Het
Sema6d T A 2: 124,507,197 (GRCm39) S1045T probably benign Het
Skida1 A T 2: 18,051,402 (GRCm39) N496K unknown Het
Slc29a2 A T 19: 5,080,448 (GRCm39) I397F probably benign Het
Slc38a2 G T 15: 96,590,294 (GRCm39) R316S probably damaging Het
Slc40a1 A C 1: 45,951,498 (GRCm39) Y220D probably damaging Het
Strc T G 2: 121,208,012 (GRCm39) H453P probably damaging Het
Tmprss3 T A 17: 31,407,358 (GRCm39) I312F probably damaging Het
Tnn G A 1: 159,958,256 (GRCm39) T529I probably damaging Het
Tnr A T 1: 159,713,801 (GRCm39) D743V possibly damaging Het
Trim42 A T 9: 97,245,174 (GRCm39) F542Y probably benign Het
Trpm2 A T 10: 77,747,236 (GRCm39) Y1421N possibly damaging Het
Ttn T C 2: 76,576,901 (GRCm39) E24664G probably damaging Het
Ube2q2 T C 9: 55,092,250 (GRCm39) probably null Het
Unc79 A T 12: 103,045,297 (GRCm39) R824S probably benign Het
V1ra8 A G 6: 90,180,559 (GRCm39) D254G probably damaging Het
Vmn1r173 A T 7: 23,401,959 (GRCm39) I65F probably damaging Het
Vmn2r16 T A 5: 109,488,138 (GRCm39) M337K probably benign Het
Wfs1 C A 5: 37,125,431 (GRCm39) G487C probably damaging Het
Xdh T C 17: 74,242,926 (GRCm39) Y127C probably damaging Het
Zfp229 T C 17: 21,965,815 (GRCm39) S682P probably damaging Het
Zscan4-ps1 A T 7: 10,802,447 (GRCm39) D117E possibly damaging Het
Other mutations in Scube2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Scube2 APN 7 109,407,661 (GRCm39) missense probably damaging 1.00
IGL01608:Scube2 APN 7 109,442,461 (GRCm39) missense probably benign
IGL02080:Scube2 APN 7 109,451,685 (GRCm39) missense probably damaging 1.00
PIT4445001:Scube2 UTSW 7 109,408,387 (GRCm39) missense probably benign 0.22
R0020:Scube2 UTSW 7 109,430,095 (GRCm39) splice site probably benign
R0020:Scube2 UTSW 7 109,430,095 (GRCm39) splice site probably benign
R0106:Scube2 UTSW 7 109,446,115 (GRCm39) splice site probably benign
R0230:Scube2 UTSW 7 109,423,971 (GRCm39) critical splice donor site probably null
R0255:Scube2 UTSW 7 109,424,079 (GRCm39) missense probably damaging 0.98
R0427:Scube2 UTSW 7 109,424,044 (GRCm39) missense probably benign 0.00
R0612:Scube2 UTSW 7 109,403,971 (GRCm39) splice site probably benign
R0658:Scube2 UTSW 7 109,436,327 (GRCm39) splice site probably benign
R0687:Scube2 UTSW 7 109,428,335 (GRCm39) missense possibly damaging 0.47
R1087:Scube2 UTSW 7 109,430,882 (GRCm39) missense probably damaging 1.00
R1366:Scube2 UTSW 7 109,403,821 (GRCm39) missense probably damaging 1.00
R1635:Scube2 UTSW 7 109,442,421 (GRCm39) missense possibly damaging 0.90
R1797:Scube2 UTSW 7 109,430,882 (GRCm39) missense probably damaging 1.00
R1972:Scube2 UTSW 7 109,408,421 (GRCm39) missense probably benign 0.16
R2080:Scube2 UTSW 7 109,407,712 (GRCm39) missense possibly damaging 0.77
R2254:Scube2 UTSW 7 109,424,666 (GRCm39) missense possibly damaging 0.47
R2315:Scube2 UTSW 7 109,403,908 (GRCm39) missense probably damaging 1.00
R2325:Scube2 UTSW 7 109,443,161 (GRCm39) missense probably damaging 1.00
R3723:Scube2 UTSW 7 109,407,613 (GRCm39) splice site probably benign
R3887:Scube2 UTSW 7 109,442,383 (GRCm39) splice site probably benign
R3946:Scube2 UTSW 7 109,456,797 (GRCm39) missense possibly damaging 0.81
R4030:Scube2 UTSW 7 109,430,978 (GRCm39) missense probably benign 0.09
R4621:Scube2 UTSW 7 109,399,857 (GRCm39) missense possibly damaging 0.63
R4684:Scube2 UTSW 7 109,409,920 (GRCm39) missense probably damaging 0.96
R4736:Scube2 UTSW 7 109,430,412 (GRCm39) missense probably benign 0.01
R5096:Scube2 UTSW 7 109,398,451 (GRCm39) utr 3 prime probably benign
R5266:Scube2 UTSW 7 109,408,437 (GRCm39) missense probably damaging 1.00
R5579:Scube2 UTSW 7 109,409,944 (GRCm39) missense probably damaging 1.00
R5669:Scube2 UTSW 7 109,424,646 (GRCm39) missense probably benign 0.04
R5838:Scube2 UTSW 7 109,407,651 (GRCm39) missense probably damaging 1.00
R5916:Scube2 UTSW 7 109,430,931 (GRCm39) missense possibly damaging 0.77
R6056:Scube2 UTSW 7 109,432,220 (GRCm39) nonsense probably null
R6731:Scube2 UTSW 7 109,409,944 (GRCm39) missense probably damaging 1.00
R6785:Scube2 UTSW 7 109,409,824 (GRCm39) missense probably benign
R8197:Scube2 UTSW 7 109,407,684 (GRCm39) missense possibly damaging 0.53
R8250:Scube2 UTSW 7 109,463,377 (GRCm39) missense probably benign 0.20
R8273:Scube2 UTSW 7 109,408,383 (GRCm39) missense probably benign 0.00
R8882:Scube2 UTSW 7 109,451,680 (GRCm39) missense probably damaging 1.00
R9258:Scube2 UTSW 7 109,398,515 (GRCm39) missense probably damaging 1.00
R9428:Scube2 UTSW 7 109,428,345 (GRCm39) missense probably benign 0.32
R9476:Scube2 UTSW 7 109,430,969 (GRCm39) missense probably damaging 1.00
R9510:Scube2 UTSW 7 109,430,969 (GRCm39) missense probably damaging 1.00
R9709:Scube2 UTSW 7 109,430,971 (GRCm39) missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109,442,408 (GRCm39) missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109,437,334 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGATCTCTAAGCACTCACC -3'
(R):5'- TCAGAATGGAAAGCTCTCTGAG -3'

Sequencing Primer
(F):5'- TCTTCAGGGACATGGCCATG -3'
(R):5'- TCTCTGAGAGCAGCCACC -3'
Posted On 2020-10-20