Mutagenetix > Incidental Mutation

Incidental Mutation 'R8427:Plat'

653527

Institutional Source

Beutler Lab

Gene Symbol

Plat

Ensembl Gene

ENSMUSG00000031538

Gene Name

plasminogen activator, tissue

Synonyms

t-PA, D8Ertd2e, tPA

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8427 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

22757727-22782844 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 22772232 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Tryptophan at position 91 (G91W)

Ref Sequence

ENSEMBL: ENSMUSP00000033941 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033941]

AlphaFold

P11214

Predicted Effect

probably damaging
Transcript: ENSMUST00000033941
AA Change: G91W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000033941
Gene: ENSMUSG00000031538
AA Change: G91W

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
FN1	38	80	5.69e-15	SMART
EGF	82	117	4.92e-5	SMART
KR	122	207	3.77e-33	SMART
KR	211	296	4.39e-34	SMART
Tryp_SPc	308	553	6.59e-84	SMART

Meta Mutation Damage Score

0.8810

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a key enzyme of the fibrinolytic pathway. The encoded protein undergoes proteolytic processing by plasmin to generate a heterodimeric serine protease that cleaves the proenzyme plasminogen to produce plasmin, a protease that is required to break down fibrin clots. Additionally, the encoded protein is involved in other biological processes such as synaptic plasticity, cell migration and tissue remodeling. Mice lacking the encoded protein display a reduction in long-term potentiation in hippocampus and conversely, transgenic mice overexpressing the encoded protein have increased and prolonged long-term potentiation. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal behavior, CNS synpatic transmission, and response to injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447C04Rik	G	T	12: 72,903,286	S271R	possibly damaging	Het
Adrb2	A	G	18: 62,179,274	V160A	possibly damaging	Het
Atp13a5	T	C	16: 29,349,002	D113G	possibly damaging	Het
B4galt7	T	A	13: 55,609,325	V312D	possibly damaging	Het
Bccip	A	G	7: 133,709,491	D45G	probably benign	Het
Bcl2l2	A	G	14: 54,885,403	Y151C	probably damaging	Het
Ccdc146	T	C	5: 21,399,792	E16G	unknown	Het
Cdr2l	C	A	11: 115,394,039	D400E	probably damaging	Het
Celsr2	A	C	3: 108,392,633	*2920E	probably null	Het
Cib1	A	G	7: 80,228,001	F183L	probably damaging	Het
Cnot1	A	G	8: 95,734,324	Y1716H	probably benign	Het
Copb1	A	G	7: 114,226,754	V665A	probably benign	Het
Crmp1	C	T	5: 37,291,195	T683I	probably damaging	Het
Cubn	G	C	2: 13,428,756	F1114L	probably benign	Het
Dab2	A	T	15: 6,429,359	R251*	probably null	Het
Ddx28	A	G	8: 106,010,280	V382A	probably benign	Het
Eml1	C	A	12: 108,530,321	T612K	probably damaging	Het
Hoxb3	CGGCGGTGGCGG	CGGCGGTGGCGGTGGCGG	11: 96,345,589		probably benign	Het
Hoxb3	TGGCGG	TGGCGGAGGCGG	11: 96,345,595		probably benign	Het
Iapp	T	A	6: 142,298,886	I13N	probably damaging	Het
Ifit1bl1	A	T	19: 34,599,266		probably null	Het
Itgb4	T	A	11: 115,991,718		probably null	Het
Kcnh3	T	C	15: 99,227,053	V128A	probably benign	Het
Kmt2a	A	G	9: 44,845,423	F1176L	probably damaging	Het
Lifr	A	G	15: 7,190,981	T1031A	probably benign	Het
Lrp2	T	C	2: 69,451,297	D3910G	probably damaging	Het
Man1a2	A	T	3: 100,684,685	S60T	probably benign	Het
Mdh1	C	T	11: 21,564,138	R93K	probably benign	Het
Mical1	G	T	10: 41,478,595	K142N	probably damaging	Het
Nf2	T	A	11: 4,791,118	E365D	probably benign	Het
Nfrkb	A	G	9: 31,419,027	M1192V	probably benign	Het
Npas4	A	C	19: 4,986,080	D685E	probably benign	Het
Olfr1291-ps1	A	G	2: 111,499,965	T238A	probably damaging	Het
Olfr358	G	T	2: 37,004,782	Y277*	probably null	Het
Olfr747	T	A	14: 50,681,149	I162F	probably damaging	Het
Ovch2	G	A	7: 107,794,000	T222I	probably damaging	Het
Pld1	A	T	3: 28,088,646	I668F	probably damaging	Het
Plscr4	C	T	9: 92,490,790	R322*	probably null	Het
Ppa1	A	G	10: 61,660,925	D64G	possibly damaging	Het
Rnf133	T	C	6: 23,649,406	I175V	probably benign	Het
Rpp30	A	G	19: 36,094,412	I127V	probably benign	Het
Scube2	T	A	7: 109,800,590	H913L	probably damaging	Het
Sema6d	T	A	2: 124,665,277	S1045T	probably benign	Het
Skida1	A	T	2: 18,046,591	N496K	unknown	Het
Slc29a2	A	T	19: 5,030,420	I397F	probably benign	Het
Slc38a2	G	T	15: 96,692,413	R316S	probably damaging	Het
Slc40a1	A	C	1: 45,912,338	Y220D	probably damaging	Het
Strc	T	G	2: 121,377,531	H453P	probably damaging	Het
Tmprss3	T	A	17: 31,188,384	I312F	probably damaging	Het
Tnn	G	A	1: 160,130,686	T529I	probably damaging	Het
Tnr	A	T	1: 159,886,231	D743V	possibly damaging	Het
Trim42	A	T	9: 97,363,121	F542Y	probably benign	Het
Trpm2	A	T	10: 77,911,402	Y1421N	possibly damaging	Het
Ttn	T	C	2: 76,746,557	E24664G	probably damaging	Het
Ube2q2	T	C	9: 55,184,966		probably null	Het
Unc79	A	T	12: 103,079,038	R824S	probably benign	Het
V1ra8	A	G	6: 90,203,577	D254G	probably damaging	Het
Vmn1r173	A	T	7: 23,702,534	I65F	probably damaging	Het
Vmn2r16	T	A	5: 109,340,272	M337K	probably benign	Het
Wfs1	C	A	5: 36,968,087	G487C	probably damaging	Het
Xdh	T	C	17: 73,935,931	Y127C	probably damaging	Het
Zfp229	T	C	17: 21,746,834	S682P	probably damaging	Het
Zscan4-ps1	A	T	7: 11,068,520	D117E	possibly damaging	Het

Other mutations in Plat

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01457:Plat	APN	8	22776828	missense	probably benign	0.00
IGL01918:Plat	APN	8	22780437	missense	possibly damaging	0.82
IGL01998:Plat	APN	8	22767147	missense	probably benign	0.31
IGL02978:Plat	APN	8	22776819	missense	probably damaging	1.00
R0829:Plat	UTSW	8	22772257	missense	probably damaging	1.00
R1065:Plat	UTSW	8	22776863	missense	probably damaging	0.99
R2316:Plat	UTSW	8	22776865	missense	probably benign	0.04
R4485:Plat	UTSW	8	22772212	missense	probably benign	0.01
R4873:Plat	UTSW	8	22768450	missense	probably benign	0.03
R4875:Plat	UTSW	8	22768450	missense	probably benign	0.03
R4924:Plat	UTSW	8	22778253	missense	probably damaging	1.00
R5051:Plat	UTSW	8	22773672	missense	probably benign	0.01
R5062:Plat	UTSW	8	22772311	missense	probably benign	0.19
R5402:Plat	UTSW	8	22772722	missense	probably damaging	1.00
R5672:Plat	UTSW	8	22773648	missense	probably benign	0.40
R6306:Plat	UTSW	8	22772266	missense	possibly damaging	0.83
R7035:Plat	UTSW	8	22772311	missense	probably benign	0.32
R7154:Plat	UTSW	8	22778505	missense	possibly damaging	0.76
R7297:Plat	UTSW	8	22775697	missense	probably benign	0.12
R7432:Plat	UTSW	8	22773651	missense	probably damaging	0.99
R7514:Plat	UTSW	8	22775642	missense	probably damaging	1.00
R7679:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R7680:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R7742:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R7834:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R7885:Plat	UTSW	8	22771720	missense	probably benign	0.00
R7918:Plat	UTSW	8	22773639	missense	probably damaging	1.00
R8039:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8040:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8243:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8347:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8355:Plat	UTSW	8	22771742	nonsense	probably null
R8422:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8423:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8424:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8426:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8485:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8507:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8510:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8714:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8716:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8717:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R9140:Plat	UTSW	8	22780546	missense	probably damaging	1.00
R9148:Plat	UTSW	8	22778450	missense	probably damaging	0.99
R9289:Plat	UTSW	8	22782084	missense	probably damaging	1.00
R9328:Plat	UTSW	8	22778117	missense	probably damaging	1.00
R9378:Plat	UTSW	8	22775583	missense	probably damaging	1.00
R9557:Plat	UTSW	8	22772653	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ATACTTTCCATGCTTCGCGG -3'
(R):5'- TCAAGTCTCTAAATGACCTCAGC -3'

Sequencing Primer
(F):5'- CATGCTTCGCGGTTGACAG -3'
(R):5'- AGCTCCCCTTCTGTGGG -3'

Posted On

2020-10-20