Incidental Mutation 'R8427:Nfrkb'
ID 653530
Institutional Source Beutler Lab
Gene Symbol Nfrkb
Ensembl Gene ENSMUSG00000042185
Gene Name nuclear factor related to kappa B binding protein
Synonyms A530090G11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.860) question?
Stock # R8427 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 31386192-31421333 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 31419027 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 1192 (M1192V)
Ref Sequence ENSEMBL: ENSMUSP00000083341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086167] [ENSMUST00000132329] [ENSMUST00000152593]
AlphaFold Q6PIJ4
Predicted Effect probably benign
Transcript: ENSMUST00000086167
AA Change: M1192V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000083341
Gene: ENSMUSG00000042185
AA Change: M1192V

DomainStartEndE-ValueType
low complexity region 209 234 N/A INTRINSIC
coiled coil region 304 335 N/A INTRINSIC
Pfam:NFRKB_winged 379 478 4.5e-35 PFAM
low complexity region 663 690 N/A INTRINSIC
low complexity region 700 740 N/A INTRINSIC
internal_repeat_1 879 953 2.02e-5 PROSPERO
low complexity region 1016 1034 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
internal_repeat_1 1128 1201 2.02e-5 PROSPERO
low complexity region 1239 1255 N/A INTRINSIC
low complexity region 1269 1290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132329
Predicted Effect probably benign
Transcript: ENSMUST00000152593
SMART Domains Protein: ENSMUSP00000119025
Gene: ENSMUSG00000042185

DomainStartEndE-ValueType
low complexity region 209 234 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik G T 12: 72,903,286 S271R possibly damaging Het
Adrb2 A G 18: 62,179,274 V160A possibly damaging Het
Atp13a5 T C 16: 29,349,002 D113G possibly damaging Het
B4galt7 T A 13: 55,609,325 V312D possibly damaging Het
Bccip A G 7: 133,709,491 D45G probably benign Het
Bcl2l2 A G 14: 54,885,403 Y151C probably damaging Het
Ccdc146 T C 5: 21,399,792 E16G unknown Het
Cdr2l C A 11: 115,394,039 D400E probably damaging Het
Celsr2 A C 3: 108,392,633 *2920E probably null Het
Cib1 A G 7: 80,228,001 F183L probably damaging Het
Cnot1 A G 8: 95,734,324 Y1716H probably benign Het
Copb1 A G 7: 114,226,754 V665A probably benign Het
Crmp1 C T 5: 37,291,195 T683I probably damaging Het
Cubn G C 2: 13,428,756 F1114L probably benign Het
Dab2 A T 15: 6,429,359 R251* probably null Het
Ddx28 A G 8: 106,010,280 V382A probably benign Het
Eml1 C A 12: 108,530,321 T612K probably damaging Het
Hoxb3 CGGCGGTGGCGG CGGCGGTGGCGGTGGCGG 11: 96,345,589 probably benign Het
Hoxb3 TGGCGG TGGCGGAGGCGG 11: 96,345,595 probably benign Het
Iapp T A 6: 142,298,886 I13N probably damaging Het
Ifit1bl1 A T 19: 34,599,266 probably null Het
Itgb4 T A 11: 115,991,718 probably null Het
Kcnh3 T C 15: 99,227,053 V128A probably benign Het
Kmt2a A G 9: 44,845,423 F1176L probably damaging Het
Lifr A G 15: 7,190,981 T1031A probably benign Het
Lrp2 T C 2: 69,451,297 D3910G probably damaging Het
Man1a2 A T 3: 100,684,685 S60T probably benign Het
Mdh1 C T 11: 21,564,138 R93K probably benign Het
Mical1 G T 10: 41,478,595 K142N probably damaging Het
Nf2 T A 11: 4,791,118 E365D probably benign Het
Npas4 A C 19: 4,986,080 D685E probably benign Het
Olfr1291-ps1 A G 2: 111,499,965 T238A probably damaging Het
Olfr358 G T 2: 37,004,782 Y277* probably null Het
Olfr747 T A 14: 50,681,149 I162F probably damaging Het
Ovch2 G A 7: 107,794,000 T222I probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pld1 A T 3: 28,088,646 I668F probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ppa1 A G 10: 61,660,925 D64G possibly damaging Het
Rnf133 T C 6: 23,649,406 I175V probably benign Het
Rpp30 A G 19: 36,094,412 I127V probably benign Het
Scube2 T A 7: 109,800,590 H913L probably damaging Het
Sema6d T A 2: 124,665,277 S1045T probably benign Het
Skida1 A T 2: 18,046,591 N496K unknown Het
Slc29a2 A T 19: 5,030,420 I397F probably benign Het
Slc38a2 G T 15: 96,692,413 R316S probably damaging Het
Slc40a1 A C 1: 45,912,338 Y220D probably damaging Het
Strc T G 2: 121,377,531 H453P probably damaging Het
Tmprss3 T A 17: 31,188,384 I312F probably damaging Het
Tnn G A 1: 160,130,686 T529I probably damaging Het
Tnr A T 1: 159,886,231 D743V possibly damaging Het
Trim42 A T 9: 97,363,121 F542Y probably benign Het
Trpm2 A T 10: 77,911,402 Y1421N possibly damaging Het
Ttn T C 2: 76,746,557 E24664G probably damaging Het
Ube2q2 T C 9: 55,184,966 probably null Het
Unc79 A T 12: 103,079,038 R824S probably benign Het
V1ra8 A G 6: 90,203,577 D254G probably damaging Het
Vmn1r173 A T 7: 23,702,534 I65F probably damaging Het
Vmn2r16 T A 5: 109,340,272 M337K probably benign Het
Wfs1 C A 5: 36,968,087 G487C probably damaging Het
Xdh T C 17: 73,935,931 Y127C probably damaging Het
Zfp229 T C 17: 21,746,834 S682P probably damaging Het
Zscan4-ps1 A T 7: 11,068,520 D117E possibly damaging Het
Other mutations in Nfrkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Nfrkb APN 9 31389049 missense probably damaging 0.99
IGL01343:Nfrkb APN 9 31388954 missense probably damaging 0.99
IGL01363:Nfrkb APN 9 31414371 missense possibly damaging 0.53
IGL01647:Nfrkb APN 9 31396505 splice site probably benign
IGL01655:Nfrkb APN 9 31403459 missense probably benign 0.09
IGL01735:Nfrkb APN 9 31410139 missense possibly damaging 0.73
IGL01926:Nfrkb APN 9 31414179 missense probably benign 0.01
IGL01929:Nfrkb APN 9 31419873 missense possibly damaging 0.73
IGL02095:Nfrkb APN 9 31411231 missense probably damaging 0.97
IGL02370:Nfrkb APN 9 31389012 missense probably benign 0.08
IGL02525:Nfrkb APN 9 31414516 missense possibly damaging 0.73
R0325:Nfrkb UTSW 9 31414180 missense probably benign 0.06
R0390:Nfrkb UTSW 9 31388897 start gained probably benign
R0558:Nfrkb UTSW 9 31410268 missense possibly damaging 0.73
R0670:Nfrkb UTSW 9 31420173 missense probably benign 0.33
R1329:Nfrkb UTSW 9 31414647 missense possibly damaging 0.93
R1729:Nfrkb UTSW 9 31414636 missense probably benign 0.00
R1730:Nfrkb UTSW 9 31414636 missense probably benign 0.00
R1894:Nfrkb UTSW 9 31414768 missense probably benign 0.02
R1975:Nfrkb UTSW 9 31414684 missense possibly damaging 0.86
R2022:Nfrkb UTSW 9 31411250 missense probably benign 0.04
R2175:Nfrkb UTSW 9 31389014 missense possibly damaging 0.73
R3793:Nfrkb UTSW 9 31409932 splice site probably benign
R4020:Nfrkb UTSW 9 31414111 missense possibly damaging 0.96
R4425:Nfrkb UTSW 9 31399962 missense probably damaging 0.99
R4727:Nfrkb UTSW 9 31403623 missense probably damaging 0.99
R4730:Nfrkb UTSW 9 31410251 missense probably benign 0.33
R4775:Nfrkb UTSW 9 31419049 missense possibly damaging 0.86
R5032:Nfrkb UTSW 9 31389055 splice site probably null
R5532:Nfrkb UTSW 9 31397779 missense probably damaging 1.00
R5635:Nfrkb UTSW 9 31399298 missense probably damaging 0.98
R5712:Nfrkb UTSW 9 31414636 missense probably benign 0.00
R5720:Nfrkb UTSW 9 31394742 missense probably damaging 1.00
R6448:Nfrkb UTSW 9 31394789 missense probably damaging 1.00
R6543:Nfrkb UTSW 9 31400985 nonsense probably null
R6612:Nfrkb UTSW 9 31397006 nonsense probably null
R7087:Nfrkb UTSW 9 31419932 nonsense probably null
R7123:Nfrkb UTSW 9 31414015 critical splice acceptor site probably null
R7483:Nfrkb UTSW 9 31414032 nonsense probably null
R7875:Nfrkb UTSW 9 31410154 missense possibly damaging 0.53
R8336:Nfrkb UTSW 9 31403519 missense possibly damaging 0.64
R8370:Nfrkb UTSW 9 31405579 missense probably damaging 1.00
R8518:Nfrkb UTSW 9 31399965 missense probably damaging 0.99
R9607:Nfrkb UTSW 9 31414770 missense possibly damaging 0.73
R9627:Nfrkb UTSW 9 31409893 missense possibly damaging 0.96
R9679:Nfrkb UTSW 9 31410089 missense probably benign
T0975:Nfrkb UTSW 9 31397083 missense probably benign 0.04
Z1088:Nfrkb UTSW 9 31411333 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGGAACATTGGGACCCTTGG -3'
(R):5'- CGCTTTCTACACGCAATATATACTG -3'

Sequencing Primer
(F):5'- CCTTGGGGAAATGAGGGTTG -3'
(R):5'- CTCTATCCAAAACAGTACTGGGGATG -3'
Posted On 2020-10-20