Incidental Mutation 'R8427:Kmt2a'
ID 653531
Institutional Source Beutler Lab
Gene Symbol Kmt2a
Ensembl Gene ENSMUSG00000002028
Gene Name lysine (K)-specific methyltransferase 2A
Synonyms Mll, ALL-1, Mll1, Cxxc7, All1, HTRX1, trithorax Drosophila
MMRRC Submission 067821-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8427 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 44714652-44792594 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 44756720 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1176 (F1176L)
Ref Sequence ENSEMBL: ENSMUSP00000110337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002095] [ENSMUST00000114689] [ENSMUST00000128768] [ENSMUST00000215489]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000002095
AA Change: F1176L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000002095
Gene: ENSMUSG00000002028
AA Change: F1176L

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 41 102 N/A INTRINSIC
PDB:3U88|N 103 151 6e-15 PDB
AT_hook 171 183 2.12e2 SMART
AT_hook 217 229 4.68e1 SMART
AT_hook 298 310 2.8e0 SMART
coiled coil region 366 394 N/A INTRINSIC
low complexity region 450 489 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 544 574 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 760 790 N/A INTRINSIC
low complexity region 866 892 N/A INTRINSIC
low complexity region 989 1005 N/A INTRINSIC
Pfam:zf-CXXC 1144 1191 1.1e-15 PFAM
low complexity region 1204 1233 N/A INTRINSIC
low complexity region 1236 1283 N/A INTRINSIC
low complexity region 1295 1316 N/A INTRINSIC
low complexity region 1323 1345 N/A INTRINSIC
low complexity region 1353 1366 N/A INTRINSIC
PHD 1432 1479 5.57e-3 SMART
PHD 1480 1530 1.17e-10 SMART
PHD 1567 1624 7.94e-8 SMART
BROMO 1632 1766 2.24e-10 SMART
low complexity region 1816 1850 N/A INTRINSIC
PHD 1931 1977 1.74e-4 SMART
low complexity region 1990 2001 N/A INTRINSIC
FYRN 2029 2072 2.33e-20 SMART
low complexity region 2180 2194 N/A INTRINSIC
low complexity region 2215 2227 N/A INTRINSIC
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2789 2800 N/A INTRINSIC
low complexity region 2824 2833 N/A INTRINSIC
low complexity region 2856 2878 N/A INTRINSIC
low complexity region 2902 2909 N/A INTRINSIC
low complexity region 3115 3141 N/A INTRINSIC
low complexity region 3164 3175 N/A INTRINSIC
low complexity region 3228 3239 N/A INTRINSIC
low complexity region 3299 3312 N/A INTRINSIC
low complexity region 3342 3351 N/A INTRINSIC
low complexity region 3405 3419 N/A INTRINSIC
low complexity region 3498 3526 N/A INTRINSIC
low complexity region 3620 3633 N/A INTRINSIC
FYRC 3662 3747 8.54e-37 SMART
SET 3823 3945 6.09e-45 SMART
PostSET 3947 3963 1.65e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114689
AA Change: F1176L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110337
Gene: ENSMUSG00000002028
AA Change: F1176L

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 41 102 N/A INTRINSIC
PDB:3U88|N 103 151 6e-15 PDB
AT_hook 171 183 2.12e2 SMART
AT_hook 217 229 4.68e1 SMART
AT_hook 298 310 2.8e0 SMART
coiled coil region 366 394 N/A INTRINSIC
low complexity region 450 489 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 544 574 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 760 790 N/A INTRINSIC
low complexity region 866 892 N/A INTRINSIC
low complexity region 989 1005 N/A INTRINSIC
Pfam:zf-CXXC 1144 1191 1.1e-15 PFAM
low complexity region 1204 1233 N/A INTRINSIC
low complexity region 1236 1283 N/A INTRINSIC
low complexity region 1295 1316 N/A INTRINSIC
low complexity region 1323 1345 N/A INTRINSIC
low complexity region 1353 1366 N/A INTRINSIC
PHD 1432 1479 5.57e-3 SMART
PHD 1480 1530 1.17e-10 SMART
PHD 1567 1627 9.12e-8 SMART
BROMO 1635 1769 2.24e-10 SMART
low complexity region 1819 1853 N/A INTRINSIC
PHD 1934 1980 1.74e-4 SMART
low complexity region 1993 2004 N/A INTRINSIC
FYRN 2032 2075 2.33e-20 SMART
low complexity region 2183 2197 N/A INTRINSIC
low complexity region 2218 2230 N/A INTRINSIC
low complexity region 2610 2621 N/A INTRINSIC
low complexity region 2792 2803 N/A INTRINSIC
low complexity region 2827 2836 N/A INTRINSIC
low complexity region 2859 2881 N/A INTRINSIC
low complexity region 2905 2912 N/A INTRINSIC
low complexity region 3118 3144 N/A INTRINSIC
low complexity region 3167 3178 N/A INTRINSIC
low complexity region 3231 3242 N/A INTRINSIC
low complexity region 3302 3315 N/A INTRINSIC
low complexity region 3345 3354 N/A INTRINSIC
low complexity region 3408 3422 N/A INTRINSIC
low complexity region 3501 3529 N/A INTRINSIC
low complexity region 3623 3636 N/A INTRINSIC
FYRC 3665 3750 8.54e-37 SMART
SET 3826 3948 6.09e-45 SMART
PostSET 3950 3966 1.65e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128768
AA Change: F1209L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122541
Gene: ENSMUSG00000002028
AA Change: F1209L

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
SCOP:d1gkub1 59 105 6e-3 SMART
PDB:3U88|N 103 131 2e-10 PDB
low complexity region 132 142 N/A INTRINSIC
AT_hook 204 216 2.12e2 SMART
AT_hook 250 262 4.68e1 SMART
AT_hook 331 343 2.8e0 SMART
coiled coil region 399 427 N/A INTRINSIC
low complexity region 483 522 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
low complexity region 577 607 N/A INTRINSIC
low complexity region 622 634 N/A INTRINSIC
low complexity region 693 707 N/A INTRINSIC
low complexity region 750 765 N/A INTRINSIC
low complexity region 793 823 N/A INTRINSIC
low complexity region 899 925 N/A INTRINSIC
low complexity region 1022 1038 N/A INTRINSIC
Pfam:zf-CXXC 1177 1224 2.4e-16 PFAM
low complexity region 1237 1266 N/A INTRINSIC
low complexity region 1269 1316 N/A INTRINSIC
Blast:BROMO 1317 1438 3e-14 BLAST
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000215489
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional coactivator that plays an essential role in regulating gene expression during early development and hematopoiesis. The encoded protein contains multiple conserved functional domains. One of these domains, the SET domain, is responsible for its histone H3 lysine 4 (H3K4) methyltransferase activity which mediates chromatin modifications associated with epigenetic transcriptional activation. This protein is processed by the enzyme Taspase 1 into two fragments, MLL-C and MLL-N. These fragments reassociate and further assemble into different multiprotein complexes that regulate the transcription of specific target genes, including many of the HOX genes. Multiple chromosomal translocations involving this gene are the cause of certain acute lymphoid leukemias and acute myeloid leukemias. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygotes for targeted null mutations die at embryonic day 11.5-14.5 with edematous bodies, petechiae, and hematopoietic insufficiency. Heterozygotes show reduced growth, hematopoietic abnormalities, and homeotic transformations of the axial skeleton. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik G T 12: 72,950,060 (GRCm39) S271R possibly damaging Het
Adrb2 A G 18: 62,312,345 (GRCm39) V160A possibly damaging Het
Atp13a5 T C 16: 29,167,820 (GRCm39) D113G possibly damaging Het
B4galt7 T A 13: 55,757,138 (GRCm39) V312D possibly damaging Het
Bccip A G 7: 133,311,220 (GRCm39) D45G probably benign Het
Bcl2l2 A G 14: 55,122,860 (GRCm39) Y151C probably damaging Het
Ccdc146 T C 5: 21,604,790 (GRCm39) E16G unknown Het
Cdr2l C A 11: 115,284,865 (GRCm39) D400E probably damaging Het
Celsr2 A C 3: 108,299,949 (GRCm39) *2920E probably null Het
Cib1 A G 7: 79,877,749 (GRCm39) F183L probably damaging Het
Cnot1 A G 8: 96,460,952 (GRCm39) Y1716H probably benign Het
Copb1 A G 7: 113,825,989 (GRCm39) V665A probably benign Het
Crmp1 C T 5: 37,448,539 (GRCm39) T683I probably damaging Het
Cubn G C 2: 13,433,567 (GRCm39) F1114L probably benign Het
Dab2 A T 15: 6,458,840 (GRCm39) R251* probably null Het
Ddx28 A G 8: 106,736,912 (GRCm39) V382A probably benign Het
Eml1 C A 12: 108,496,580 (GRCm39) T612K probably damaging Het
Hoxb3 CGGCGGTGGCGG CGGCGGTGGCGGTGGCGG 11: 96,236,415 (GRCm39) probably benign Het
Hoxb3 TGGCGG TGGCGGAGGCGG 11: 96,236,421 (GRCm39) probably benign Het
Iapp T A 6: 142,244,612 (GRCm39) I13N probably damaging Het
Ifit1bl1 A T 19: 34,576,666 (GRCm39) probably null Het
Itgb4 T A 11: 115,882,544 (GRCm39) probably null Het
Kcnh3 T C 15: 99,124,934 (GRCm39) V128A probably benign Het
Lifr A G 15: 7,220,462 (GRCm39) T1031A probably benign Het
Lrp2 T C 2: 69,281,641 (GRCm39) D3910G probably damaging Het
Man1a2 A T 3: 100,592,001 (GRCm39) S60T probably benign Het
Mdh1 C T 11: 21,514,138 (GRCm39) R93K probably benign Het
Mical1 G T 10: 41,354,591 (GRCm39) K142N probably damaging Het
Nf2 T A 11: 4,741,118 (GRCm39) E365D probably benign Het
Nfrkb A G 9: 31,330,323 (GRCm39) M1192V probably benign Het
Npas4 A C 19: 5,036,108 (GRCm39) D685E probably benign Het
Or11h4b T A 14: 50,918,606 (GRCm39) I162F probably damaging Het
Or12k5 G T 2: 36,894,794 (GRCm39) Y277* probably null Het
Or4f4-ps1 A G 2: 111,330,310 (GRCm39) T238A probably damaging Het
Ovch2 G A 7: 107,393,207 (GRCm39) T222I probably damaging Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Pld1 A T 3: 28,142,795 (GRCm39) I668F probably damaging Het
Plscr4 C T 9: 92,372,843 (GRCm39) R322* probably null Het
Ppa1 A G 10: 61,496,704 (GRCm39) D64G possibly damaging Het
Rnf133 T C 6: 23,649,405 (GRCm39) I175V probably benign Het
Rpp30 A G 19: 36,071,812 (GRCm39) I127V probably benign Het
Scube2 T A 7: 109,399,797 (GRCm39) H913L probably damaging Het
Sema6d T A 2: 124,507,197 (GRCm39) S1045T probably benign Het
Skida1 A T 2: 18,051,402 (GRCm39) N496K unknown Het
Slc29a2 A T 19: 5,080,448 (GRCm39) I397F probably benign Het
Slc38a2 G T 15: 96,590,294 (GRCm39) R316S probably damaging Het
Slc40a1 A C 1: 45,951,498 (GRCm39) Y220D probably damaging Het
Strc T G 2: 121,208,012 (GRCm39) H453P probably damaging Het
Tmprss3 T A 17: 31,407,358 (GRCm39) I312F probably damaging Het
Tnn G A 1: 159,958,256 (GRCm39) T529I probably damaging Het
Tnr A T 1: 159,713,801 (GRCm39) D743V possibly damaging Het
Trim42 A T 9: 97,245,174 (GRCm39) F542Y probably benign Het
Trpm2 A T 10: 77,747,236 (GRCm39) Y1421N possibly damaging Het
Ttn T C 2: 76,576,901 (GRCm39) E24664G probably damaging Het
Ube2q2 T C 9: 55,092,250 (GRCm39) probably null Het
Unc79 A T 12: 103,045,297 (GRCm39) R824S probably benign Het
V1ra8 A G 6: 90,180,559 (GRCm39) D254G probably damaging Het
Vmn1r173 A T 7: 23,401,959 (GRCm39) I65F probably damaging Het
Vmn2r16 T A 5: 109,488,138 (GRCm39) M337K probably benign Het
Wfs1 C A 5: 37,125,431 (GRCm39) G487C probably damaging Het
Xdh T C 17: 74,242,926 (GRCm39) Y127C probably damaging Het
Zfp229 T C 17: 21,965,815 (GRCm39) S682P probably damaging Het
Zscan4-ps1 A T 7: 10,802,447 (GRCm39) D117E possibly damaging Het
Other mutations in Kmt2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Kmt2a APN 9 44,719,231 (GRCm39) unclassified probably benign
IGL00667:Kmt2a APN 9 44,735,683 (GRCm39) utr 3 prime probably benign
IGL00828:Kmt2a APN 9 44,732,073 (GRCm39) unclassified probably benign
IGL01080:Kmt2a APN 9 44,720,389 (GRCm39) missense unknown
IGL01131:Kmt2a APN 9 44,732,467 (GRCm39) unclassified probably benign
IGL01294:Kmt2a APN 9 44,731,594 (GRCm39) unclassified probably benign
IGL01432:Kmt2a APN 9 44,720,393 (GRCm39) missense unknown
IGL01646:Kmt2a APN 9 44,736,781 (GRCm39) utr 3 prime probably benign
IGL01777:Kmt2a APN 9 44,760,302 (GRCm39) missense probably damaging 0.99
IGL01944:Kmt2a APN 9 44,761,064 (GRCm39) missense probably damaging 1.00
IGL02125:Kmt2a APN 9 44,759,983 (GRCm39) missense probably damaging 1.00
IGL02207:Kmt2a APN 9 44,758,979 (GRCm39) missense probably damaging 0.98
IGL02424:Kmt2a APN 9 44,735,932 (GRCm39) utr 3 prime probably benign
IGL02499:Kmt2a APN 9 44,741,806 (GRCm39) splice site probably benign
IGL02574:Kmt2a APN 9 44,741,810 (GRCm39) splice site probably benign
IGL02711:Kmt2a APN 9 44,735,820 (GRCm39) splice site probably benign
IGL02828:Kmt2a APN 9 44,733,244 (GRCm39) unclassified probably benign
IGL03012:Kmt2a APN 9 44,722,263 (GRCm39) unclassified probably benign
IGL03242:Kmt2a APN 9 44,759,689 (GRCm39) missense probably damaging 0.99
IGL03294:Kmt2a APN 9 44,731,862 (GRCm39) unclassified probably benign
IGL03326:Kmt2a APN 9 44,730,044 (GRCm39) nonsense probably null
Chromas UTSW 9 44,731,639 (GRCm39) unclassified probably benign
Heteros UTSW 9 44,740,108 (GRCm39) nonsense probably null
Polonium UTSW 9 44,725,938 (GRCm39) nonsense probably null
Pyknos UTSW 9 44,738,125 (GRCm39) utr 3 prime probably benign
Skies UTSW 9 44,740,558 (GRCm39) utr 3 prime probably benign
spacious UTSW 9 44,758,942 (GRCm39) missense probably benign 0.03
ukrainium UTSW 9 44,753,997 (GRCm39) unclassified probably benign
Uranium UTSW 9 44,761,154 (GRCm39) nonsense probably null
PIT4402001:Kmt2a UTSW 9 44,752,359 (GRCm39) missense unknown
R0076:Kmt2a UTSW 9 44,741,356 (GRCm39) utr 3 prime probably benign
R0076:Kmt2a UTSW 9 44,741,356 (GRCm39) utr 3 prime probably benign
R0180:Kmt2a UTSW 9 44,738,148 (GRCm39) utr 3 prime probably benign
R0363:Kmt2a UTSW 9 44,721,010 (GRCm39) critical splice donor site probably null
R0411:Kmt2a UTSW 9 44,731,261 (GRCm39) unclassified probably benign
R0555:Kmt2a UTSW 9 44,758,868 (GRCm39) missense probably damaging 1.00
R0587:Kmt2a UTSW 9 44,758,831 (GRCm39) missense probably damaging 0.99
R0865:Kmt2a UTSW 9 44,730,067 (GRCm39) unclassified probably benign
R0988:Kmt2a UTSW 9 44,759,846 (GRCm39) missense probably benign 0.03
R1006:Kmt2a UTSW 9 44,758,993 (GRCm39) missense probably damaging 0.99
R1108:Kmt2a UTSW 9 44,760,359 (GRCm39) missense probably damaging 1.00
R1292:Kmt2a UTSW 9 44,725,991 (GRCm39) utr 3 prime probably benign
R1322:Kmt2a UTSW 9 44,732,418 (GRCm39) unclassified probably benign
R1476:Kmt2a UTSW 9 44,735,932 (GRCm39) utr 3 prime probably benign
R1485:Kmt2a UTSW 9 44,738,225 (GRCm39) utr 3 prime probably benign
R1487:Kmt2a UTSW 9 44,745,287 (GRCm39) utr 3 prime probably benign
R1493:Kmt2a UTSW 9 44,758,202 (GRCm39) missense probably damaging 1.00
R1499:Kmt2a UTSW 9 44,759,563 (GRCm39) missense probably benign 0.36
R1507:Kmt2a UTSW 9 44,729,700 (GRCm39) unclassified probably benign
R1603:Kmt2a UTSW 9 44,752,858 (GRCm39) splice site probably null
R1635:Kmt2a UTSW 9 44,735,666 (GRCm39) utr 3 prime probably benign
R1662:Kmt2a UTSW 9 44,747,967 (GRCm39) utr 3 prime probably benign
R1711:Kmt2a UTSW 9 44,752,918 (GRCm39) missense unknown
R1785:Kmt2a UTSW 9 44,730,972 (GRCm39) unclassified probably benign
R1786:Kmt2a UTSW 9 44,730,972 (GRCm39) unclassified probably benign
R1919:Kmt2a UTSW 9 44,731,642 (GRCm39) unclassified probably benign
R1964:Kmt2a UTSW 9 44,731,941 (GRCm39) missense probably benign 0.23
R1965:Kmt2a UTSW 9 44,732,757 (GRCm39) unclassified probably benign
R2029:Kmt2a UTSW 9 44,729,747 (GRCm39) missense probably benign 0.23
R2054:Kmt2a UTSW 9 44,734,671 (GRCm39) utr 3 prime probably benign
R2259:Kmt2a UTSW 9 44,792,440 (GRCm39) unclassified probably benign
R2382:Kmt2a UTSW 9 44,732,207 (GRCm39) unclassified probably benign
R2483:Kmt2a UTSW 9 44,760,263 (GRCm39) missense probably damaging 0.99
R3033:Kmt2a UTSW 9 44,733,160 (GRCm39) unclassified probably benign
R3423:Kmt2a UTSW 9 44,731,394 (GRCm39) unclassified probably benign
R3428:Kmt2a UTSW 9 44,759,416 (GRCm39) missense probably benign 0.06
R3605:Kmt2a UTSW 9 44,760,493 (GRCm39) missense probably damaging 1.00
R3607:Kmt2a UTSW 9 44,760,493 (GRCm39) missense probably damaging 1.00
R3611:Kmt2a UTSW 9 44,733,763 (GRCm39) unclassified probably benign
R3623:Kmt2a UTSW 9 44,760,263 (GRCm39) missense probably damaging 0.99
R3745:Kmt2a UTSW 9 44,742,637 (GRCm39) utr 3 prime probably benign
R3806:Kmt2a UTSW 9 44,731,653 (GRCm39) unclassified probably benign
R3841:Kmt2a UTSW 9 44,742,588 (GRCm39) utr 3 prime probably benign
R3855:Kmt2a UTSW 9 44,741,796 (GRCm39) utr 3 prime probably benign
R4027:Kmt2a UTSW 9 44,747,990 (GRCm39) utr 3 prime probably benign
R4124:Kmt2a UTSW 9 44,731,093 (GRCm39) unclassified probably benign
R4177:Kmt2a UTSW 9 44,732,280 (GRCm39) unclassified probably benign
R4296:Kmt2a UTSW 9 44,732,472 (GRCm39) unclassified probably benign
R4414:Kmt2a UTSW 9 44,721,077 (GRCm39) unclassified probably benign
R4461:Kmt2a UTSW 9 44,760,263 (GRCm39) missense probably damaging 0.99
R4668:Kmt2a UTSW 9 44,735,869 (GRCm39) utr 3 prime probably benign
R4761:Kmt2a UTSW 9 44,760,421 (GRCm39) missense probably damaging 1.00
R4812:Kmt2a UTSW 9 44,742,651 (GRCm39) utr 3 prime probably benign
R4815:Kmt2a UTSW 9 44,732,553 (GRCm39) unclassified probably benign
R4817:Kmt2a UTSW 9 44,732,763 (GRCm39) unclassified probably benign
R4888:Kmt2a UTSW 9 44,732,977 (GRCm39) unclassified probably benign
R4958:Kmt2a UTSW 9 44,759,764 (GRCm39) missense probably damaging 1.00
R5055:Kmt2a UTSW 9 44,729,649 (GRCm39) unclassified probably benign
R5065:Kmt2a UTSW 9 44,753,997 (GRCm39) unclassified probably benign
R5185:Kmt2a UTSW 9 44,731,543 (GRCm39) unclassified probably benign
R5358:Kmt2a UTSW 9 44,730,571 (GRCm39) unclassified probably benign
R5411:Kmt2a UTSW 9 44,759,782 (GRCm39) missense probably damaging 1.00
R5420:Kmt2a UTSW 9 44,759,633 (GRCm39) missense probably damaging 1.00
R5483:Kmt2a UTSW 9 44,735,921 (GRCm39) utr 3 prime probably benign
R5487:Kmt2a UTSW 9 44,733,272 (GRCm39) unclassified probably benign
R5488:Kmt2a UTSW 9 44,752,335 (GRCm39) utr 3 prime probably benign
R5489:Kmt2a UTSW 9 44,752,335 (GRCm39) utr 3 prime probably benign
R5538:Kmt2a UTSW 9 44,731,639 (GRCm39) unclassified probably benign
R5576:Kmt2a UTSW 9 44,753,931 (GRCm39) missense possibly damaging 0.94
R5631:Kmt2a UTSW 9 44,731,985 (GRCm39) unclassified probably benign
R5781:Kmt2a UTSW 9 44,759,139 (GRCm39) nonsense probably null
R5789:Kmt2a UTSW 9 44,731,201 (GRCm39) unclassified probably benign
R5932:Kmt2a UTSW 9 44,731,944 (GRCm39) unclassified probably benign
R6027:Kmt2a UTSW 9 44,730,587 (GRCm39) unclassified probably benign
R6191:Kmt2a UTSW 9 44,738,125 (GRCm39) utr 3 prime probably benign
R6239:Kmt2a UTSW 9 44,731,093 (GRCm39) unclassified probably benign
R6291:Kmt2a UTSW 9 44,744,171 (GRCm39) utr 3 prime probably benign
R6344:Kmt2a UTSW 9 44,733,156 (GRCm39) unclassified probably benign
R6611:Kmt2a UTSW 9 44,760,569 (GRCm39) missense probably damaging 0.98
R6641:Kmt2a UTSW 9 44,731,132 (GRCm39) unclassified probably benign
R6651:Kmt2a UTSW 9 44,740,108 (GRCm39) nonsense probably null
R6825:Kmt2a UTSW 9 44,729,704 (GRCm39) unclassified probably benign
R6853:Kmt2a UTSW 9 44,729,704 (GRCm39) unclassified probably benign
R6897:Kmt2a UTSW 9 44,758,942 (GRCm39) missense probably benign 0.03
R6930:Kmt2a UTSW 9 44,753,962 (GRCm39) unclassified probably benign
R6932:Kmt2a UTSW 9 44,740,558 (GRCm39) utr 3 prime probably benign
R6957:Kmt2a UTSW 9 44,731,319 (GRCm39) unclassified probably benign
R7170:Kmt2a UTSW 9 44,722,018 (GRCm39) missense unknown
R7202:Kmt2a UTSW 9 44,759,012 (GRCm39) missense probably benign 0.03
R7481:Kmt2a UTSW 9 44,720,368 (GRCm39) missense unknown
R7538:Kmt2a UTSW 9 44,759,041 (GRCm39) missense probably damaging 0.99
R7597:Kmt2a UTSW 9 44,742,650 (GRCm39) missense unknown
R7741:Kmt2a UTSW 9 44,719,359 (GRCm39) missense unknown
R7767:Kmt2a UTSW 9 44,730,295 (GRCm39) missense unknown
R7768:Kmt2a UTSW 9 44,731,900 (GRCm39) missense unknown
R7861:Kmt2a UTSW 9 44,730,031 (GRCm39) missense unknown
R7894:Kmt2a UTSW 9 44,761,154 (GRCm39) nonsense probably null
R7922:Kmt2a UTSW 9 44,754,157 (GRCm39) missense unknown
R7943:Kmt2a UTSW 9 44,760,437 (GRCm39) missense probably damaging 0.97
R7997:Kmt2a UTSW 9 44,745,220 (GRCm39) missense unknown
R8033:Kmt2a UTSW 9 44,756,767 (GRCm39) missense probably damaging 1.00
R8055:Kmt2a UTSW 9 44,732,378 (GRCm39) missense unknown
R8139:Kmt2a UTSW 9 44,730,587 (GRCm39) unclassified probably benign
R8156:Kmt2a UTSW 9 44,733,686 (GRCm39) missense unknown
R8224:Kmt2a UTSW 9 44,719,326 (GRCm39) missense unknown
R8535:Kmt2a UTSW 9 44,730,812 (GRCm39) missense possibly damaging 0.91
R8693:Kmt2a UTSW 9 44,721,981 (GRCm39) missense unknown
R8757:Kmt2a UTSW 9 44,754,210 (GRCm39) missense unknown
R8840:Kmt2a UTSW 9 44,721,016 (GRCm39) missense unknown
R8933:Kmt2a UTSW 9 44,733,802 (GRCm39) unclassified probably benign
R8998:Kmt2a UTSW 9 44,733,174 (GRCm39) missense unknown
R9013:Kmt2a UTSW 9 44,761,208 (GRCm39) missense probably damaging 0.97
R9053:Kmt2a UTSW 9 44,732,716 (GRCm39) missense unknown
R9084:Kmt2a UTSW 9 44,740,130 (GRCm39) missense unknown
R9146:Kmt2a UTSW 9 44,725,938 (GRCm39) nonsense probably null
R9162:Kmt2a UTSW 9 44,759,363 (GRCm39) missense probably benign 0.32
R9231:Kmt2a UTSW 9 44,759,912 (GRCm39) missense probably damaging 0.99
R9250:Kmt2a UTSW 9 44,759,683 (GRCm39) missense possibly damaging 0.82
R9262:Kmt2a UTSW 9 44,731,222 (GRCm39) missense probably benign 0.23
R9323:Kmt2a UTSW 9 44,731,261 (GRCm39) unclassified probably benign
R9472:Kmt2a UTSW 9 44,733,453 (GRCm39) missense unknown
R9510:Kmt2a UTSW 9 44,734,531 (GRCm39) missense unknown
R9524:Kmt2a UTSW 9 44,730,294 (GRCm39) missense unknown
R9662:Kmt2a UTSW 9 44,731,428 (GRCm39) missense unknown
R9664:Kmt2a UTSW 9 44,760,102 (GRCm39) nonsense probably null
R9691:Kmt2a UTSW 9 44,731,557 (GRCm39) missense unknown
R9750:Kmt2a UTSW 9 44,747,499 (GRCm39) missense unknown
X0021:Kmt2a UTSW 9 44,742,532 (GRCm39) utr 3 prime probably benign
X0025:Kmt2a UTSW 9 44,736,689 (GRCm39) nonsense probably null
X0026:Kmt2a UTSW 9 44,732,203 (GRCm39) unclassified probably benign
X0027:Kmt2a UTSW 9 44,792,194 (GRCm39) missense possibly damaging 0.85
Z1176:Kmt2a UTSW 9 44,759,276 (GRCm39) missense probably damaging 1.00
Z1177:Kmt2a UTSW 9 44,730,418 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CTGTCCTATACTAGACGGCATGG -3'
(R):5'- AGTTGCTGGCTCAGAAGATGC -3'

Sequencing Primer
(F):5'- TGGCTGCAGAATACTTACTCAGC -3'
(R):5'- TCAGAAGATGCCGAGCCTCTTG -3'
Posted On 2020-10-20