Incidental Mutation 'R8427:Trpm2'
ID 653537
Institutional Source Beutler Lab
Gene Symbol Trpm2
Ensembl Gene ENSMUSG00000009292
Gene Name transient receptor potential cation channel, subfamily M, member 2
Synonyms LTRPC2, 9830168K16Rik, TRPC7, Trrp7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock # R8427 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 77907722-77970563 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 77911402 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 1421 (Y1421N)
Ref Sequence ENSEMBL: ENSMUSP00000101040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105401]
AlphaFold Q91YD4
Predicted Effect possibly damaging
Transcript: ENSMUST00000105401
AA Change: Y1421N

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: Y1421N

DomainStartEndE-ValueType
low complexity region 654 672 N/A INTRINSIC
transmembrane domain 750 772 N/A INTRINSIC
Pfam:Ion_trans 794 1057 3.7e-21 PFAM
low complexity region 1078 1090 N/A INTRINSIC
low complexity region 1106 1115 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
PDB:1QVJ|A 1236 1506 3e-37 PDB
SCOP:d1k2ea_ 1369 1502 9e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik G T 12: 72,903,286 S271R possibly damaging Het
Adrb2 A G 18: 62,179,274 V160A possibly damaging Het
Atp13a5 T C 16: 29,349,002 D113G possibly damaging Het
B4galt7 T A 13: 55,609,325 V312D possibly damaging Het
Bccip A G 7: 133,709,491 D45G probably benign Het
Bcl2l2 A G 14: 54,885,403 Y151C probably damaging Het
Ccdc146 T C 5: 21,399,792 E16G unknown Het
Cdr2l C A 11: 115,394,039 D400E probably damaging Het
Celsr2 A C 3: 108,392,633 *2920E probably null Het
Cib1 A G 7: 80,228,001 F183L probably damaging Het
Cnot1 A G 8: 95,734,324 Y1716H probably benign Het
Copb1 A G 7: 114,226,754 V665A probably benign Het
Crmp1 C T 5: 37,291,195 T683I probably damaging Het
Cubn G C 2: 13,428,756 F1114L probably benign Het
Dab2 A T 15: 6,429,359 R251* probably null Het
Ddx28 A G 8: 106,010,280 V382A probably benign Het
Eml1 C A 12: 108,530,321 T612K probably damaging Het
Hoxb3 CGGCGGTGGCGG CGGCGGTGGCGGTGGCGG 11: 96,345,589 probably benign Het
Hoxb3 TGGCGG TGGCGGAGGCGG 11: 96,345,595 probably benign Het
Iapp T A 6: 142,298,886 I13N probably damaging Het
Ifit1bl1 A T 19: 34,599,266 probably null Het
Itgb4 T A 11: 115,991,718 probably null Het
Kcnh3 T C 15: 99,227,053 V128A probably benign Het
Kmt2a A G 9: 44,845,423 F1176L probably damaging Het
Lifr A G 15: 7,190,981 T1031A probably benign Het
Lrp2 T C 2: 69,451,297 D3910G probably damaging Het
Man1a2 A T 3: 100,684,685 S60T probably benign Het
Mdh1 C T 11: 21,564,138 R93K probably benign Het
Mical1 G T 10: 41,478,595 K142N probably damaging Het
Nf2 T A 11: 4,791,118 E365D probably benign Het
Nfrkb A G 9: 31,419,027 M1192V probably benign Het
Npas4 A C 19: 4,986,080 D685E probably benign Het
Olfr1291-ps1 A G 2: 111,499,965 T238A probably damaging Het
Olfr358 G T 2: 37,004,782 Y277* probably null Het
Olfr747 T A 14: 50,681,149 I162F probably damaging Het
Ovch2 G A 7: 107,794,000 T222I probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pld1 A T 3: 28,088,646 I668F probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ppa1 A G 10: 61,660,925 D64G possibly damaging Het
Rnf133 T C 6: 23,649,406 I175V probably benign Het
Rpp30 A G 19: 36,094,412 I127V probably benign Het
Scube2 T A 7: 109,800,590 H913L probably damaging Het
Sema6d T A 2: 124,665,277 S1045T probably benign Het
Skida1 A T 2: 18,046,591 N496K unknown Het
Slc29a2 A T 19: 5,030,420 I397F probably benign Het
Slc38a2 G T 15: 96,692,413 R316S probably damaging Het
Slc40a1 A C 1: 45,912,338 Y220D probably damaging Het
Strc T G 2: 121,377,531 H453P probably damaging Het
Tmprss3 T A 17: 31,188,384 I312F probably damaging Het
Tnn G A 1: 160,130,686 T529I probably damaging Het
Tnr A T 1: 159,886,231 D743V possibly damaging Het
Trim42 A T 9: 97,363,121 F542Y probably benign Het
Ttn T C 2: 76,746,557 E24664G probably damaging Het
Ube2q2 T C 9: 55,184,966 probably null Het
Unc79 A T 12: 103,079,038 R824S probably benign Het
V1ra8 A G 6: 90,203,577 D254G probably damaging Het
Vmn1r173 A T 7: 23,702,534 I65F probably damaging Het
Vmn2r16 T A 5: 109,340,272 M337K probably benign Het
Wfs1 C A 5: 36,968,087 G487C probably damaging Het
Xdh T C 17: 73,935,931 Y127C probably damaging Het
Zfp229 T C 17: 21,746,834 S682P probably damaging Het
Zscan4-ps1 A T 7: 11,068,520 D117E possibly damaging Het
Other mutations in Trpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Trpm2 APN 10 77942915 splice site probably null
IGL00773:Trpm2 APN 10 77949214 nonsense probably null
IGL00962:Trpm2 APN 10 77943916 splice site probably benign
IGL01093:Trpm2 APN 10 77932280 missense probably benign 0.04
IGL01124:Trpm2 APN 10 77945825 splice site probably benign
IGL01301:Trpm2 APN 10 77923984 missense probably damaging 1.00
IGL02094:Trpm2 APN 10 77942996 nonsense probably null
IGL02175:Trpm2 APN 10 77937907 missense probably benign 0.07
IGL02653:Trpm2 APN 10 77912669 missense probably benign 0.19
IGL02667:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02668:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02828:Trpm2 APN 10 77918986 missense probably benign 0.16
IGL02951:Trpm2 APN 10 77929278 missense possibly damaging 0.95
IGL03188:Trpm2 APN 10 77918909 missense probably benign 0.18
IGL03242:Trpm2 APN 10 77917734 missense probably benign
IGL03405:Trpm2 APN 10 77966072 splice site probably benign
Fugit UTSW 10 77938368 missense probably damaging 1.00
scusate UTSW 10 77966994 nonsense probably null
temporal UTSW 10 77925682 missense probably benign 0.30
ANU18:Trpm2 UTSW 10 77923984 missense probably damaging 1.00
R0147:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0148:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0302:Trpm2 UTSW 10 77943990 splice site probably benign
R0332:Trpm2 UTSW 10 77947988 missense probably damaging 1.00
R0586:Trpm2 UTSW 10 77923516 missense probably damaging 0.99
R0847:Trpm2 UTSW 10 77929288 missense possibly damaging 0.94
R1183:Trpm2 UTSW 10 77923564 missense probably damaging 1.00
R1472:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R1510:Trpm2 UTSW 10 77966994 nonsense probably null
R1518:Trpm2 UTSW 10 77943005 missense possibly damaging 0.67
R1564:Trpm2 UTSW 10 77942999 missense probably benign 0.14
R1593:Trpm2 UTSW 10 77943076 missense possibly damaging 0.71
R1617:Trpm2 UTSW 10 77935875 splice site probably null
R1673:Trpm2 UTSW 10 77942944 missense probably benign
R1912:Trpm2 UTSW 10 77945876 missense probably benign 0.10
R1932:Trpm2 UTSW 10 77941158 missense probably damaging 1.00
R1993:Trpm2 UTSW 10 77947989 missense probably damaging 1.00
R2013:Trpm2 UTSW 10 77925766 missense probably damaging 1.00
R2151:Trpm2 UTSW 10 77932179 missense probably benign 0.01
R2201:Trpm2 UTSW 10 77920471 nonsense probably null
R2217:Trpm2 UTSW 10 77941182 missense probably damaging 1.00
R2312:Trpm2 UTSW 10 77918964 missense probably benign 0.04
R2339:Trpm2 UTSW 10 77914806 splice site probably benign
R2395:Trpm2 UTSW 10 77947880 missense possibly damaging 0.69
R2396:Trpm2 UTSW 10 77930637 missense probably benign 0.14
R2405:Trpm2 UTSW 10 77934724 missense probably damaging 1.00
R2567:Trpm2 UTSW 10 77941174 missense probably damaging 0.99
R3001:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3002:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3125:Trpm2 UTSW 10 77911374 missense probably damaging 1.00
R3500:Trpm2 UTSW 10 77932302 missense probably benign 0.03
R3777:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R3778:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R4272:Trpm2 UTSW 10 77933642 missense probably damaging 1.00
R4384:Trpm2 UTSW 10 77917725 missense probably benign 0.44
R4395:Trpm2 UTSW 10 77929219 missense probably benign 0.01
R4423:Trpm2 UTSW 10 77935068 missense probably benign 0.00
R4452:Trpm2 UTSW 10 77923593 missense probably damaging 1.00
R4612:Trpm2 UTSW 10 77945916 missense probably damaging 0.99
R4662:Trpm2 UTSW 10 77938138 missense probably benign 0.05
R4825:Trpm2 UTSW 10 77941173 missense probably damaging 0.98
R4906:Trpm2 UTSW 10 77932189 nonsense probably null
R4943:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R4948:Trpm2 UTSW 10 77917792 missense probably benign 0.34
R5046:Trpm2 UTSW 10 77966018 missense probably damaging 1.00
R5320:Trpm2 UTSW 10 77923521 missense probably benign 0.06
R5523:Trpm2 UTSW 10 77935961 missense probably benign 0.04
R5562:Trpm2 UTSW 10 77959939 missense possibly damaging 0.71
R5623:Trpm2 UTSW 10 77932139 missense probably damaging 0.96
R5628:Trpm2 UTSW 10 77912636 missense probably benign 0.00
R5633:Trpm2 UTSW 10 77938353 missense possibly damaging 0.71
R5817:Trpm2 UTSW 10 77965980 missense probably damaging 1.00
R5989:Trpm2 UTSW 10 77959900 missense probably damaging 1.00
R6018:Trpm2 UTSW 10 77917713 missense probably benign 0.00
R6075:Trpm2 UTSW 10 77935043 critical splice donor site probably null
R6092:Trpm2 UTSW 10 77925682 missense probably benign 0.30
R6309:Trpm2 UTSW 10 77938368 missense probably damaging 1.00
R6327:Trpm2 UTSW 10 77932227 missense probably damaging 1.00
R6568:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6579:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6640:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6642:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6798:Trpm2 UTSW 10 77914740 missense probably damaging 0.99
R6999:Trpm2 UTSW 10 77935891 missense probably damaging 1.00
R7034:Trpm2 UTSW 10 77912592 missense probably benign
R7036:Trpm2 UTSW 10 77912592 missense probably benign
R7113:Trpm2 UTSW 10 77947931 missense probably damaging 0.96
R7171:Trpm2 UTSW 10 77924014 missense probably damaging 1.00
R7240:Trpm2 UTSW 10 77935876 critical splice donor site probably null
R7274:Trpm2 UTSW 10 77923555 missense probably benign 0.00
R7379:Trpm2 UTSW 10 77914734 missense probably benign
R7527:Trpm2 UTSW 10 77966060 missense probably benign 0.01
R7571:Trpm2 UTSW 10 77937950 missense probably benign 0.21
R7600:Trpm2 UTSW 10 77938051 missense probably benign 0.02
R7727:Trpm2 UTSW 10 77925789 missense probably benign 0.34
R7771:Trpm2 UTSW 10 77932179 missense probably benign 0.01
R7844:Trpm2 UTSW 10 77923506 missense probably benign 0.00
R8158:Trpm2 UTSW 10 77947897 missense probably damaging 0.99
R8225:Trpm2 UTSW 10 77947973 missense probably damaging 1.00
R8226:Trpm2 UTSW 10 77947973 missense probably damaging 1.00
R8239:Trpm2 UTSW 10 77936002 missense probably benign 0.06
R8275:Trpm2 UTSW 10 77966025 nonsense probably null
R8340:Trpm2 UTSW 10 77923624 nonsense probably null
R8354:Trpm2 UTSW 10 77933649 missense probably damaging 1.00
R8445:Trpm2 UTSW 10 77910252 missense probably damaging 1.00
R8769:Trpm2 UTSW 10 77932294 missense probably benign 0.00
R9144:Trpm2 UTSW 10 77929288 missense probably benign 0.01
R9286:Trpm2 UTSW 10 77941180 missense probably benign 0.06
R9319:Trpm2 UTSW 10 77942942 nonsense probably null
R9319:Trpm2 UTSW 10 77949198 missense probably damaging 1.00
R9381:Trpm2 UTSW 10 77911357 missense possibly damaging 0.90
Z1177:Trpm2 UTSW 10 77937868 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCTGAAACATGTCTGGAGCATTTC -3'
(R):5'- TTGACTTGTGCCAGAGGTCAG -3'

Sequencing Primer
(F):5'- ACATGTCTGGAGCATTTCACCATG -3'
(R):5'- ACATGTACTGGGGAGTCTCAAGC -3'
Posted On 2020-10-20