Mutagenetix > Incidental Mutations

Incidental Mutation 'R8427:Trpm2'

653537

Institutional Source

Beutler Lab

Gene Symbol

Trpm2

Ensembl Gene

ENSMUSG00000009292

Gene Name

transient receptor potential cation channel, subfamily M, member 2

Synonyms

LTRPC2, 9830168K16Rik, TRPC7, Trrp7

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.124) question?

Stock #

R8427 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

77907722-77970563 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 77911402 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 1421 (Y1421N)

Ref Sequence

ENSEMBL: ENSMUSP00000101040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105401]

AlphaFold

Q91YD4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105401
AA Change: Y1421N

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: Y1421N

Domain	Start	End	E-Value	Type
low complexity region	654	672	N/A	INTRINSIC
transmembrane domain	750	772	N/A	INTRINSIC
Pfam:Ion_trans	794	1057	3.7e-21	PFAM
low complexity region	1078	1090	N/A	INTRINSIC
low complexity region	1106	1115	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC
PDB:1QVJ\|A	1236	1506	3e-37	PDB
SCOP:d1k2ea_	1369	1502	9e-10	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447C04Rik	G	T	12: 72,903,286	S271R	possibly damaging	Het
Adrb2	A	G	18: 62,179,274	V160A	possibly damaging	Het
Atp13a5	T	C	16: 29,349,002	D113G	possibly damaging	Het
B4galt7	T	A	13: 55,609,325	V312D	possibly damaging	Het
Bccip	A	G	7: 133,709,491	D45G	probably benign	Het
Bcl2l2	A	G	14: 54,885,403	Y151C	probably damaging	Het
Ccdc146	T	C	5: 21,399,792	E16G	unknown	Het
Cdr2l	C	A	11: 115,394,039	D400E	probably damaging	Het
Celsr2	A	C	3: 108,392,633	*2920E	probably null	Het
Cib1	A	G	7: 80,228,001	F183L	probably damaging	Het
Cnot1	A	G	8: 95,734,324	Y1716H	probably benign	Het
Copb1	A	G	7: 114,226,754	V665A	probably benign	Het
Crmp1	C	T	5: 37,291,195	T683I	probably damaging	Het
Cubn	G	C	2: 13,428,756	F1114L	probably benign	Het
Dab2	A	T	15: 6,429,359	R251*	probably null	Het
Ddx28	A	G	8: 106,010,280	V382A	probably benign	Het
Eml1	C	A	12: 108,530,321	T612K	probably damaging	Het
Hoxb3	CGGCGGTGGCGG	CGGCGGTGGCGGTGGCGG	11: 96,345,589		probably benign	Het
Hoxb3	TGGCGG	TGGCGGAGGCGG	11: 96,345,595		probably benign	Het
Iapp	T	A	6: 142,298,886	I13N	probably damaging	Het
Ifit1bl1	A	T	19: 34,599,266		probably null	Het
Itgb4	T	A	11: 115,991,718		probably null	Het
Kcnh3	T	C	15: 99,227,053	V128A	probably benign	Het
Kmt2a	A	G	9: 44,845,423	F1176L	probably damaging	Het
Lifr	A	G	15: 7,190,981	T1031A	probably benign	Het
Lrp2	T	C	2: 69,451,297	D3910G	probably damaging	Het
Man1a2	A	T	3: 100,684,685	S60T	probably benign	Het
Mdh1	C	T	11: 21,564,138	R93K	probably benign	Het
Mical1	G	T	10: 41,478,595	K142N	probably damaging	Het
Nf2	T	A	11: 4,791,118	E365D	probably benign	Het
Nfrkb	A	G	9: 31,419,027	M1192V	probably benign	Het
Npas4	A	C	19: 4,986,080	D685E	probably benign	Het
Olfr1291-ps1	A	G	2: 111,499,965	T238A	probably damaging	Het
Olfr358	G	T	2: 37,004,782	Y277*	probably null	Het
Olfr747	T	A	14: 50,681,149	I162F	probably damaging	Het
Ovch2	G	A	7: 107,794,000	T222I	probably damaging	Het
Plat	G	T	8: 22,772,232	G91W	probably damaging	Het
Pld1	A	T	3: 28,088,646	I668F	probably damaging	Het
Plscr4	C	T	9: 92,490,790	R322*	probably null	Het
Ppa1	A	G	10: 61,660,925	D64G	possibly damaging	Het
Rnf133	T	C	6: 23,649,406	I175V	probably benign	Het
Rpp30	A	G	19: 36,094,412	I127V	probably benign	Het
Scube2	T	A	7: 109,800,590	H913L	probably damaging	Het
Sema6d	T	A	2: 124,665,277	S1045T	probably benign	Het
Skida1	A	T	2: 18,046,591	N496K	unknown	Het
Slc29a2	A	T	19: 5,030,420	I397F	probably benign	Het
Slc38a2	G	T	15: 96,692,413	R316S	probably damaging	Het
Slc40a1	A	C	1: 45,912,338	Y220D	probably damaging	Het
Strc	T	G	2: 121,377,531	H453P	probably damaging	Het
Tmprss3	T	A	17: 31,188,384	I312F	probably damaging	Het
Tnn	G	A	1: 160,130,686	T529I	probably damaging	Het
Tnr	A	T	1: 159,886,231	D743V	possibly damaging	Het
Trim42	A	T	9: 97,363,121	F542Y	probably benign	Het
Ttn	T	C	2: 76,746,557	E24664G	probably damaging	Het
Ube2q2	T	C	9: 55,184,966		probably null	Het
Unc79	A	T	12: 103,079,038	R824S	probably benign	Het
V1ra8	A	G	6: 90,203,577	D254G	probably damaging	Het
Vmn1r173	A	T	7: 23,702,534	I65F	probably damaging	Het
Vmn2r16	T	A	5: 109,340,272	M337K	probably benign	Het
Wfs1	C	A	5: 36,968,087	G487C	probably damaging	Het
Xdh	T	C	17: 73,935,931	Y127C	probably damaging	Het
Zfp229	T	C	17: 21,746,834	S682P	probably damaging	Het
Zscan4-ps1	A	T	7: 11,068,520	D117E	possibly damaging	Het

Other mutations in Trpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00730:Trpm2	APN	10	77942915	splice site	probably null
IGL00773:Trpm2	APN	10	77949214	nonsense	probably null
IGL00962:Trpm2	APN	10	77943916	splice site	probably benign
IGL01093:Trpm2	APN	10	77932280	missense	probably benign	0.04
IGL01124:Trpm2	APN	10	77945825	splice site	probably benign
IGL01301:Trpm2	APN	10	77923984	missense	probably damaging	1.00
IGL02094:Trpm2	APN	10	77942996	nonsense	probably null
IGL02175:Trpm2	APN	10	77937907	missense	probably benign	0.07
IGL02653:Trpm2	APN	10	77912669	missense	probably benign	0.19
IGL02667:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02668:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02828:Trpm2	APN	10	77918986	missense	probably benign	0.16
IGL02951:Trpm2	APN	10	77929278	missense	possibly damaging	0.95
IGL03188:Trpm2	APN	10	77918909	missense	probably benign	0.18
IGL03242:Trpm2	APN	10	77917734	missense	probably benign
IGL03405:Trpm2	APN	10	77966072	splice site	probably benign
Fugit	UTSW	10	77938368	missense	probably damaging	1.00
scusate	UTSW	10	77966994	nonsense	probably null
temporal	UTSW	10	77925682	missense	probably benign	0.30
ANU18:Trpm2	UTSW	10	77923984	missense	probably damaging	1.00
R0147:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0148:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0302:Trpm2	UTSW	10	77943990	splice site	probably benign
R0332:Trpm2	UTSW	10	77947988	missense	probably damaging	1.00
R0586:Trpm2	UTSW	10	77923516	missense	probably damaging	0.99
R0847:Trpm2	UTSW	10	77929288	missense	possibly damaging	0.94
R1183:Trpm2	UTSW	10	77923564	missense	probably damaging	1.00
R1472:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R1510:Trpm2	UTSW	10	77966994	nonsense	probably null
R1518:Trpm2	UTSW	10	77943005	missense	possibly damaging	0.67
R1564:Trpm2	UTSW	10	77942999	missense	probably benign	0.14
R1593:Trpm2	UTSW	10	77943076	missense	possibly damaging	0.71
R1617:Trpm2	UTSW	10	77935875	splice site	probably null
R1673:Trpm2	UTSW	10	77942944	missense	probably benign
R1912:Trpm2	UTSW	10	77945876	missense	probably benign	0.10
R1932:Trpm2	UTSW	10	77941158	missense	probably damaging	1.00
R1993:Trpm2	UTSW	10	77947989	missense	probably damaging	1.00
R2013:Trpm2	UTSW	10	77925766	missense	probably damaging	1.00
R2151:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R2201:Trpm2	UTSW	10	77920471	nonsense	probably null
R2217:Trpm2	UTSW	10	77941182	missense	probably damaging	1.00
R2312:Trpm2	UTSW	10	77918964	missense	probably benign	0.04
R2339:Trpm2	UTSW	10	77914806	splice site	probably benign
R2395:Trpm2	UTSW	10	77947880	missense	possibly damaging	0.69
R2396:Trpm2	UTSW	10	77930637	missense	probably benign	0.14
R2405:Trpm2	UTSW	10	77934724	missense	probably damaging	1.00
R2567:Trpm2	UTSW	10	77941174	missense	probably damaging	0.99
R3001:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3002:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3125:Trpm2	UTSW	10	77911374	missense	probably damaging	1.00
R3500:Trpm2	UTSW	10	77932302	missense	probably benign	0.03
R3777:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R3778:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R4272:Trpm2	UTSW	10	77933642	missense	probably damaging	1.00
R4384:Trpm2	UTSW	10	77917725	missense	probably benign	0.44
R4395:Trpm2	UTSW	10	77929219	missense	probably benign	0.01
R4423:Trpm2	UTSW	10	77935068	missense	probably benign	0.00
R4452:Trpm2	UTSW	10	77923593	missense	probably damaging	1.00
R4612:Trpm2	UTSW	10	77945916	missense	probably damaging	0.99
R4662:Trpm2	UTSW	10	77938138	missense	probably benign	0.05
R4825:Trpm2	UTSW	10	77941173	missense	probably damaging	0.98
R4906:Trpm2	UTSW	10	77932189	nonsense	probably null
R4943:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R4948:Trpm2	UTSW	10	77917792	missense	probably benign	0.34
R5046:Trpm2	UTSW	10	77966018	missense	probably damaging	1.00
R5320:Trpm2	UTSW	10	77923521	missense	probably benign	0.06
R5523:Trpm2	UTSW	10	77935961	missense	probably benign	0.04
R5562:Trpm2	UTSW	10	77959939	missense	possibly damaging	0.71
R5623:Trpm2	UTSW	10	77932139	missense	probably damaging	0.96
R5628:Trpm2	UTSW	10	77912636	missense	probably benign	0.00
R5633:Trpm2	UTSW	10	77938353	missense	possibly damaging	0.71
R5817:Trpm2	UTSW	10	77965980	missense	probably damaging	1.00
R5989:Trpm2	UTSW	10	77959900	missense	probably damaging	1.00
R6018:Trpm2	UTSW	10	77917713	missense	probably benign	0.00
R6075:Trpm2	UTSW	10	77935043	critical splice donor site	probably null
R6092:Trpm2	UTSW	10	77925682	missense	probably benign	0.30
R6309:Trpm2	UTSW	10	77938368	missense	probably damaging	1.00
R6327:Trpm2	UTSW	10	77932227	missense	probably damaging	1.00
R6568:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6579:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6640:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6642:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6798:Trpm2	UTSW	10	77914740	missense	probably damaging	0.99
R6999:Trpm2	UTSW	10	77935891	missense	probably damaging	1.00
R7034:Trpm2	UTSW	10	77912592	missense	probably benign
R7036:Trpm2	UTSW	10	77912592	missense	probably benign
R7113:Trpm2	UTSW	10	77947931	missense	probably damaging	0.96
R7171:Trpm2	UTSW	10	77924014	missense	probably damaging	1.00
R7240:Trpm2	UTSW	10	77935876	critical splice donor site	probably null
R7274:Trpm2	UTSW	10	77923555	missense	probably benign	0.00
R7379:Trpm2	UTSW	10	77914734	missense	probably benign
R7527:Trpm2	UTSW	10	77966060	missense	probably benign	0.01
R7571:Trpm2	UTSW	10	77937950	missense	probably benign	0.21
R7600:Trpm2	UTSW	10	77938051	missense	probably benign	0.02
R7727:Trpm2	UTSW	10	77925789	missense	probably benign	0.34
R7771:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R7844:Trpm2	UTSW	10	77923506	missense	probably benign	0.00
R8158:Trpm2	UTSW	10	77947897	missense	probably damaging	0.99
R8225:Trpm2	UTSW	10	77947973	missense	probably damaging	1.00
R8226:Trpm2	UTSW	10	77947973	missense	probably damaging	1.00
R8239:Trpm2	UTSW	10	77936002	missense	probably benign	0.06
R8275:Trpm2	UTSW	10	77966025	nonsense	probably null
R8340:Trpm2	UTSW	10	77923624	nonsense	probably null
R8354:Trpm2	UTSW	10	77933649	missense	probably damaging	1.00
R8445:Trpm2	UTSW	10	77910252	missense	probably damaging	1.00
R8769:Trpm2	UTSW	10	77932294	missense	probably benign	0.00
R9144:Trpm2	UTSW	10	77929288	missense	probably benign	0.01
R9286:Trpm2	UTSW	10	77941180	missense	probably benign	0.06
R9319:Trpm2	UTSW	10	77942942	nonsense	probably null
R9319:Trpm2	UTSW	10	77949198	missense	probably damaging	1.00
R9381:Trpm2	UTSW	10	77911357	missense	possibly damaging	0.90
Z1177:Trpm2	UTSW	10	77937868	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CCTGAAACATGTCTGGAGCATTTC -3'
(R):5'- TTGACTTGTGCCAGAGGTCAG -3'

Sequencing Primer
(F):5'- ACATGTCTGGAGCATTTCACCATG -3'
(R):5'- ACATGTACTGGGGAGTCTCAAGC -3'

Posted On

2020-10-20