Incidental Mutation 'R8427:Cdr2l'
ID 653542
Institutional Source Beutler Lab
Gene Symbol Cdr2l
Ensembl Gene ENSMUSG00000050910
Gene Name cerebellar degeneration-related protein 2-like
Synonyms D030068L24Rik
MMRRC Submission 067821-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.194) question?
Stock # R8427 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 115272742-115286958 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 115284865 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 400 (D400E)
Ref Sequence ENSEMBL: ENSMUSP00000052096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053288]
AlphaFold A2A6T1
Predicted Effect probably damaging
Transcript: ENSMUST00000053288
AA Change: D400E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052096
Gene: ENSMUSG00000050910
AA Change: D400E

DomainStartEndE-ValueType
coiled coil region 31 143 N/A INTRINSIC
coiled coil region 188 267 N/A INTRINSIC
low complexity region 303 310 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik G T 12: 72,950,060 (GRCm39) S271R possibly damaging Het
Adrb2 A G 18: 62,312,345 (GRCm39) V160A possibly damaging Het
Atp13a5 T C 16: 29,167,820 (GRCm39) D113G possibly damaging Het
B4galt7 T A 13: 55,757,138 (GRCm39) V312D possibly damaging Het
Bccip A G 7: 133,311,220 (GRCm39) D45G probably benign Het
Bcl2l2 A G 14: 55,122,860 (GRCm39) Y151C probably damaging Het
Ccdc146 T C 5: 21,604,790 (GRCm39) E16G unknown Het
Celsr2 A C 3: 108,299,949 (GRCm39) *2920E probably null Het
Cib1 A G 7: 79,877,749 (GRCm39) F183L probably damaging Het
Cnot1 A G 8: 96,460,952 (GRCm39) Y1716H probably benign Het
Copb1 A G 7: 113,825,989 (GRCm39) V665A probably benign Het
Crmp1 C T 5: 37,448,539 (GRCm39) T683I probably damaging Het
Cubn G C 2: 13,433,567 (GRCm39) F1114L probably benign Het
Dab2 A T 15: 6,458,840 (GRCm39) R251* probably null Het
Ddx28 A G 8: 106,736,912 (GRCm39) V382A probably benign Het
Eml1 C A 12: 108,496,580 (GRCm39) T612K probably damaging Het
Hoxb3 CGGCGGTGGCGG CGGCGGTGGCGGTGGCGG 11: 96,236,415 (GRCm39) probably benign Het
Hoxb3 TGGCGG TGGCGGAGGCGG 11: 96,236,421 (GRCm39) probably benign Het
Iapp T A 6: 142,244,612 (GRCm39) I13N probably damaging Het
Ifit1bl1 A T 19: 34,576,666 (GRCm39) probably null Het
Itgb4 T A 11: 115,882,544 (GRCm39) probably null Het
Kcnh3 T C 15: 99,124,934 (GRCm39) V128A probably benign Het
Kmt2a A G 9: 44,756,720 (GRCm39) F1176L probably damaging Het
Lifr A G 15: 7,220,462 (GRCm39) T1031A probably benign Het
Lrp2 T C 2: 69,281,641 (GRCm39) D3910G probably damaging Het
Man1a2 A T 3: 100,592,001 (GRCm39) S60T probably benign Het
Mdh1 C T 11: 21,514,138 (GRCm39) R93K probably benign Het
Mical1 G T 10: 41,354,591 (GRCm39) K142N probably damaging Het
Nf2 T A 11: 4,741,118 (GRCm39) E365D probably benign Het
Nfrkb A G 9: 31,330,323 (GRCm39) M1192V probably benign Het
Npas4 A C 19: 5,036,108 (GRCm39) D685E probably benign Het
Or11h4b T A 14: 50,918,606 (GRCm39) I162F probably damaging Het
Or12k5 G T 2: 36,894,794 (GRCm39) Y277* probably null Het
Or4f4-ps1 A G 2: 111,330,310 (GRCm39) T238A probably damaging Het
Ovch2 G A 7: 107,393,207 (GRCm39) T222I probably damaging Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Pld1 A T 3: 28,142,795 (GRCm39) I668F probably damaging Het
Plscr4 C T 9: 92,372,843 (GRCm39) R322* probably null Het
Ppa1 A G 10: 61,496,704 (GRCm39) D64G possibly damaging Het
Rnf133 T C 6: 23,649,405 (GRCm39) I175V probably benign Het
Rpp30 A G 19: 36,071,812 (GRCm39) I127V probably benign Het
Scube2 T A 7: 109,399,797 (GRCm39) H913L probably damaging Het
Sema6d T A 2: 124,507,197 (GRCm39) S1045T probably benign Het
Skida1 A T 2: 18,051,402 (GRCm39) N496K unknown Het
Slc29a2 A T 19: 5,080,448 (GRCm39) I397F probably benign Het
Slc38a2 G T 15: 96,590,294 (GRCm39) R316S probably damaging Het
Slc40a1 A C 1: 45,951,498 (GRCm39) Y220D probably damaging Het
Strc T G 2: 121,208,012 (GRCm39) H453P probably damaging Het
Tmprss3 T A 17: 31,407,358 (GRCm39) I312F probably damaging Het
Tnn G A 1: 159,958,256 (GRCm39) T529I probably damaging Het
Tnr A T 1: 159,713,801 (GRCm39) D743V possibly damaging Het
Trim42 A T 9: 97,245,174 (GRCm39) F542Y probably benign Het
Trpm2 A T 10: 77,747,236 (GRCm39) Y1421N possibly damaging Het
Ttn T C 2: 76,576,901 (GRCm39) E24664G probably damaging Het
Ube2q2 T C 9: 55,092,250 (GRCm39) probably null Het
Unc79 A T 12: 103,045,297 (GRCm39) R824S probably benign Het
V1ra8 A G 6: 90,180,559 (GRCm39) D254G probably damaging Het
Vmn1r173 A T 7: 23,401,959 (GRCm39) I65F probably damaging Het
Vmn2r16 T A 5: 109,488,138 (GRCm39) M337K probably benign Het
Wfs1 C A 5: 37,125,431 (GRCm39) G487C probably damaging Het
Xdh T C 17: 74,242,926 (GRCm39) Y127C probably damaging Het
Zfp229 T C 17: 21,965,815 (GRCm39) S682P probably damaging Het
Zscan4-ps1 A T 7: 10,802,447 (GRCm39) D117E possibly damaging Het
Other mutations in Cdr2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Cdr2l APN 11 115,283,564 (GRCm39) missense probably damaging 0.99
IGL01326:Cdr2l APN 11 115,281,796 (GRCm39) missense probably benign 0.04
IGL01411:Cdr2l APN 11 115,273,192 (GRCm39) missense probably damaging 0.99
IGL01459:Cdr2l APN 11 115,281,378 (GRCm39) missense probably damaging 1.00
IGL02971:Cdr2l APN 11 115,281,726 (GRCm39) missense probably damaging 1.00
R0135:Cdr2l UTSW 11 115,284,497 (GRCm39) missense probably damaging 1.00
R1181:Cdr2l UTSW 11 115,285,005 (GRCm39) missense probably damaging 1.00
R1598:Cdr2l UTSW 11 115,284,203 (GRCm39) missense probably damaging 0.99
R1612:Cdr2l UTSW 11 115,284,232 (GRCm39) missense probably benign 0.01
R1919:Cdr2l UTSW 11 115,283,603 (GRCm39) missense probably damaging 1.00
R2090:Cdr2l UTSW 11 115,281,827 (GRCm39) missense probably damaging 1.00
R2286:Cdr2l UTSW 11 115,283,626 (GRCm39) frame shift probably null
R4938:Cdr2l UTSW 11 115,284,651 (GRCm39) missense possibly damaging 0.86
R5114:Cdr2l UTSW 11 115,284,186 (GRCm39) missense probably damaging 1.00
R5355:Cdr2l UTSW 11 115,284,396 (GRCm39) missense possibly damaging 0.87
R6783:Cdr2l UTSW 11 115,284,495 (GRCm39) missense possibly damaging 0.56
R7156:Cdr2l UTSW 11 115,281,792 (GRCm39) missense probably benign 0.15
R8330:Cdr2l UTSW 11 115,284,939 (GRCm39) missense probably benign 0.21
R8807:Cdr2l UTSW 11 115,284,741 (GRCm39) missense probably damaging 1.00
R9081:Cdr2l UTSW 11 115,284,939 (GRCm39) missense probably damaging 1.00
R9166:Cdr2l UTSW 11 115,283,537 (GRCm39) missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- TTGCATGCCAACAGTGTGC -3'
(R):5'- GCTTTCTCACTTGCCAGGAG -3'

Sequencing Primer
(F):5'- AACAGTGTGCGCAGGCG -3'
(R):5'- CCTAGAGAGGGGTCACTTGCTG -3'
Posted On 2020-10-20