Incidental Mutation 'R8427:Eml1'
ID653546
Institutional Source Beutler Lab
Gene Symbol Eml1
Ensembl Gene ENSMUSG00000058070
Gene Nameechinoderm microtubule associated protein like 1
SynonymsA930030P13Rik, ELP79, 1110008N23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R8427 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location108370957-108539617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 108530321 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 612 (T612K)
Ref Sequence ENSEMBL: ENSMUSP00000105486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054955] [ENSMUST00000109857] [ENSMUST00000109860] [ENSMUST00000130999]
Predicted Effect probably damaging
Transcript: ENSMUST00000054955
AA Change: T581K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057209
Gene: ENSMUSG00000058070
AA Change: T581K

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
low complexity region 72 84 N/A INTRINSIC
low complexity region 119 146 N/A INTRINSIC
WD40 228 277 5.6e-3 SMART
WD40 280 325 2.21e1 SMART
WD40 328 367 4.46e-1 SMART
WD40 375 413 5.73e0 SMART
WD40 416 456 5.75e-1 SMART
WD40 496 539 4.24e-3 SMART
WD40 542 580 1.37e2 SMART
WD40 583 622 1.7e-2 SMART
WD40 629 668 1.58e-2 SMART
Blast:WD40 694 735 7e-20 BLAST
WD40 741 781 2.96e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109857
AA Change: T598K

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105483
Gene: ENSMUSG00000058070
AA Change: T598K

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
low complexity region 72 84 N/A INTRINSIC
low complexity region 119 146 N/A INTRINSIC
WD40 245 294 5.6e-3 SMART
WD40 297 342 2.21e1 SMART
WD40 345 384 4.46e-1 SMART
WD40 392 430 5.73e0 SMART
WD40 433 473 5.75e-1 SMART
WD40 513 556 4.24e-3 SMART
WD40 559 597 1.37e2 SMART
WD40 600 639 1.7e-2 SMART
WD40 646 685 1.58e-2 SMART
Blast:WD40 711 752 7e-20 BLAST
WD40 758 798 2.96e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109860
AA Change: T612K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105486
Gene: ENSMUSG00000058070
AA Change: T612K

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
coiled coil region 31 72 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 150 177 N/A INTRINSIC
Pfam:HELP 184 258 1.8e-35 PFAM
WD40 259 308 5.6e-3 SMART
WD40 311 356 2.21e1 SMART
WD40 359 398 4.46e-1 SMART
WD40 406 444 5.73e0 SMART
WD40 447 487 5.75e-1 SMART
WD40 527 570 4.24e-3 SMART
WD40 573 611 1.37e2 SMART
WD40 614 653 1.7e-2 SMART
WD40 660 699 1.58e-2 SMART
Blast:WD40 725 766 7e-20 BLAST
WD40 772 812 2.96e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000130999
AA Change: T612K

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118325
Gene: ENSMUSG00000058070
AA Change: T612K

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
coiled coil region 31 72 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 150 177 N/A INTRINSIC
WD40 259 308 5.6e-3 SMART
WD40 311 356 2.21e1 SMART
WD40 359 398 4.46e-1 SMART
WD40 406 444 5.73e0 SMART
WD40 447 487 5.75e-1 SMART
WD40 527 570 4.24e-3 SMART
WD40 573 611 1.37e2 SMART
WD40 614 653 1.7e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Human echinoderm microtubule-associated protein-like is a strong candidate for the Usher syndrome type 1A gene. Usher syndromes (USHs) are a group of genetic disorders consisting of congenital deafness, retinitis pigmentosa, and vestibular dysfunction of variable onset and severity depending on the genetic type. The disease process in USHs involves the entire brain and is not limited to the posterior fossa or auditory and visual systems. The USHs are catagorized as type I (USH1A, USH1B, USH1C, USH1D, USH1E and USH1F), type II (USH2A and USH2B) and type III (USH3). The type I is the most severe form. Gene loci responsible for these three types are all mapped. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit subcortical band heterotopia associated with seizures, developmental delay and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik G T 12: 72,903,286 S271R possibly damaging Het
Adrb2 A G 18: 62,179,274 V160A possibly damaging Het
Atp13a5 T C 16: 29,349,002 D113G possibly damaging Het
B4galt7 T A 13: 55,609,325 V312D possibly damaging Het
Bccip A G 7: 133,709,491 D45G probably benign Het
Bcl2l2 A G 14: 54,885,403 Y151C probably damaging Het
Ccdc146 T C 5: 21,399,792 E16G unknown Het
Cdr2l C A 11: 115,394,039 D400E probably damaging Het
Celsr2 A C 3: 108,392,633 *2920E probably null Het
Cib1 A G 7: 80,228,001 F183L probably damaging Het
Cnot1 A G 8: 95,734,324 Y1716H probably benign Het
Copb1 A G 7: 114,226,754 V665A probably benign Het
Crmp1 C T 5: 37,291,195 T683I probably damaging Het
Cubn G C 2: 13,428,756 F1114L probably benign Het
Dab2 A T 15: 6,429,359 R251* probably null Het
Ddx28 A G 8: 106,010,280 V382A probably benign Het
Hoxb3 CGGCGGTGGCGG CGGCGGTGGCGGTGGCGG 11: 96,345,589 probably benign Het
Hoxb3 TGGCGG TGGCGGAGGCGG 11: 96,345,595 probably benign Het
Iapp T A 6: 142,298,886 I13N probably damaging Het
Ifit1bl1 A T 19: 34,599,266 probably null Het
Itgb4 T A 11: 115,991,718 probably null Het
Kcnh3 T C 15: 99,227,053 V128A probably benign Het
Kmt2a A G 9: 44,845,423 F1176L probably damaging Het
Lifr A G 15: 7,190,981 T1031A probably benign Het
Lrp2 T C 2: 69,451,297 D3910G probably damaging Het
Man1a2 A T 3: 100,684,685 S60T probably benign Het
Mdh1 C T 11: 21,564,138 R93K probably benign Het
Mical1 G T 10: 41,478,595 K142N probably damaging Het
Nf2 T A 11: 4,791,118 E365D probably benign Het
Nfrkb A G 9: 31,419,027 M1192V probably benign Het
Npas4 A C 19: 4,986,080 D685E probably benign Het
Olfr1291-ps1 A G 2: 111,499,965 T238A probably damaging Het
Olfr358 G T 2: 37,004,782 Y277* probably null Het
Olfr747 T A 14: 50,681,149 I162F probably damaging Het
Ovch2 G A 7: 107,794,000 T222I probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pld1 A T 3: 28,088,646 I668F probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ppa1 A G 10: 61,660,925 D64G possibly damaging Het
Rnf133 T C 6: 23,649,406 I175V probably benign Het
Rpp30 A G 19: 36,094,412 I127V probably benign Het
Scube2 T A 7: 109,800,590 H913L probably damaging Het
Sema6d T A 2: 124,665,277 S1045T probably benign Het
Skida1 A T 2: 18,046,591 N496K unknown Het
Slc29a2 A T 19: 5,030,420 I397F probably benign Het
Slc38a2 G T 15: 96,692,413 R316S probably damaging Het
Slc40a1 A C 1: 45,912,338 Y220D probably damaging Het
Strc T G 2: 121,377,531 H453P probably damaging Het
Tmprss3 T A 17: 31,188,384 I312F probably damaging Het
Tnn G A 1: 160,130,686 T529I probably damaging Het
Tnr A T 1: 159,886,231 D743V possibly damaging Het
Trim42 A T 9: 97,363,121 F542Y probably benign Het
Trpm2 A T 10: 77,911,402 Y1421N possibly damaging Het
Ttn T C 2: 76,746,557 E24664G probably damaging Het
Ube2q2 T C 9: 55,184,966 probably null Het
Unc79 A T 12: 103,079,038 R824S probably benign Het
V1ra8 A G 6: 90,203,577 D254G probably damaging Het
Vmn1r173 A T 7: 23,702,534 I65F probably damaging Het
Vmn2r16 T A 5: 109,340,272 M337K probably benign Het
Wfs1 C A 5: 36,968,087 G487C probably damaging Het
Xdh T C 17: 73,935,931 Y127C probably damaging Het
Zfp229 T C 17: 21,746,834 S682P probably damaging Het
Zscan4-ps1 A T 7: 11,068,520 D117E possibly damaging Het
Other mutations in Eml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Eml1 APN 12 108514515 splice site probably null
IGL00774:Eml1 APN 12 108514515 splice site probably null
IGL01358:Eml1 APN 12 108514468 missense probably benign 0.05
IGL02316:Eml1 APN 12 108534759 intron probably benign
IGL02346:Eml1 APN 12 108537441 missense possibly damaging 0.87
IGL02480:Eml1 APN 12 108521696 missense probably benign 0.32
IGL02513:Eml1 APN 12 108530312 missense probably damaging 1.00
IGL02556:Eml1 APN 12 108537366 missense probably benign 0.00
IGL02565:Eml1 APN 12 108506520 missense probably damaging 1.00
IGL03217:Eml1 APN 12 108534942 missense probably benign 0.31
bubble UTSW 12 108513071 critical splice donor site probably null
R0027:Eml1 UTSW 12 108536298 missense possibly damaging 0.90
R0067:Eml1 UTSW 12 108463527 missense possibly damaging 0.61
R0124:Eml1 UTSW 12 108506608 missense probably benign 0.00
R0124:Eml1 UTSW 12 108509178 missense probably damaging 1.00
R0730:Eml1 UTSW 12 108530326 missense possibly damaging 0.79
R1566:Eml1 UTSW 12 108471892 missense probably damaging 0.99
R1883:Eml1 UTSW 12 108463652 missense probably damaging 0.97
R1927:Eml1 UTSW 12 108538217 nonsense probably null
R1938:Eml1 UTSW 12 108521396 missense possibly damaging 0.75
R2070:Eml1 UTSW 12 108512999 missense probably damaging 1.00
R2311:Eml1 UTSW 12 108537416 missense probably damaging 0.99
R2417:Eml1 UTSW 12 108536275 missense probably benign 0.00
R3120:Eml1 UTSW 12 108513053 missense probably benign 0.31
R4352:Eml1 UTSW 12 108534837 intron probably benign
R4471:Eml1 UTSW 12 108506635 intron probably benign
R4655:Eml1 UTSW 12 108534713 missense probably damaging 1.00
R5077:Eml1 UTSW 12 108506612 splice site probably benign
R5094:Eml1 UTSW 12 108536311 missense probably benign 0.11
R5113:Eml1 UTSW 12 108537337 missense possibly damaging 0.74
R5524:Eml1 UTSW 12 108521376 missense probably damaging 0.99
R5775:Eml1 UTSW 12 108506554 missense probably damaging 1.00
R6120:Eml1 UTSW 12 108527724 missense probably damaging 1.00
R6224:Eml1 UTSW 12 108514508 missense probably damaging 1.00
R6491:Eml1 UTSW 12 108513071 critical splice donor site probably null
R7035:Eml1 UTSW 12 108509234 missense probably damaging 1.00
R7134:Eml1 UTSW 12 108506551 missense probably benign 0.00
R7273:Eml1 UTSW 12 108538173 missense possibly damaging 0.87
R7606:Eml1 UTSW 12 108537366 missense probably benign 0.45
R7744:Eml1 UTSW 12 108516604 missense probably benign
R7820:Eml1 UTSW 12 108515174 missense possibly damaging 0.81
R8013:Eml1 UTSW 12 108521679 missense probably benign 0.18
R8223:Eml1 UTSW 12 108536310 missense probably benign 0.00
R8258:Eml1 UTSW 12 108510199 missense probably damaging 0.97
R8259:Eml1 UTSW 12 108510199 missense probably damaging 0.97
R8399:Eml1 UTSW 12 108538131 missense possibly damaging 0.91
Z1088:Eml1 UTSW 12 108537459 missense possibly damaging 0.80
Z1177:Eml1 UTSW 12 108423139 start gained probably benign
Z1177:Eml1 UTSW 12 108534656 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGAGCGTTTGTCAATATCCTG -3'
(R):5'- TGCACAGTGACGAAAAGGTTC -3'

Sequencing Primer
(F):5'- TCAATATCCTGTTCCTTTCTGTAGAG -3'
(R):5'- GCTGTCTAGTGAGCCCTACACAC -3'
Posted On2020-10-20